Transcript asmbl_43983

Sequence
Transcript Sequence for observation asmbl_43983 of TGE0005795:
CGGGCCGCTGCTGGAGTCGCCGCGGCTGCCGCGTGACGTGGCACAGCGAAAGGCTTAATACTAGAGCCGGAGCTGCCGCGCCAGTCGTAGAGCAGGTCCGCGCCCCGCTAGTACCTGACCTGGAGCTTAGTCCGAAACGCCGGCTAGCGGGCAGTTCCTGCCGCCGTCTTTCTTCCTTAGCTTCTTTTTCTCGCTCAGTTTGCCGGGAGCTTGGAAGGAGAAGGCCCGGGGACGCTCTGAACCCCTTCTGCTCCTGCCCATCGCAAGTGCCACTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTTGGCAAGAAACAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACAACCATTCTGTATAAGCTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTTACAGTATGGGATGTTGGTGGTCAAGACAAAATAAGGCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTATTTTTGTGGTAGATAGCAATGATCGTGAAAGAATTCAGGAAGGAGCTGACGAACTGCAGAAAATGCTTCAGGAAGATGAATTGCAAGATGCAGTGTTGCTGCTTTTTGCAAACAAACAGGATTTGCCAAATGCTATGGCCATCAGTGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCTACACAAGGAACTGGTCTTTATGAAGGACTTGACTGGCTGTCGAATGAACTTTCAAAACGTTAAATGAAACTGGATATTTAACCAAGGACACGTTTGATAGAATTGGTCTAGGCTTGTTACAACAAAATTAGTTTGCATCTTGGTTATTAAACAGTATCTGGGACTGGTTTGGGCAGAAGATTACAGCGTTTAAACTTATTTTGTTGCCAATTATTGTTTACCAAGTATAATGTTGCCATTTAGCAATATGCTTGGTTTTAAAGAAATTCTCCTTAACTTGGAAAAAAAAGTGTCCTCTTTTAATTTTACTTCCCTTAAGCCTAAATGCCTGGACATAGCTATTGTGACACCTTTAAATAAATCCGTTTTGAATGTTTTTTGAGCCCACAACAATAATGTTTTAAAGTTTTTCCCTTGCTACTTTACTGATACCTTTATCATTCCTGGGACAGTCTGCTGATTTAAAAATGTAGCATTCCATTTGTATTTATTTTTCTCCCTTGCCAAAAAGATTTTTTAATATCGCTTGTACCAGCCAGGAAATGTTCCAAAACACTATTCAGATCTGTTGCACTGAGGAACTTATTTTTTTGCCTGTCATTGACTCCTGGCTTCCATCAGCCAAGCTTACCTTGGTGCGGTTTGGATTTGATAGCTAAATAGTTCTTTGCTGATTGCAAAGAGTTCATATTGAGAAGAGTTTTTAATACCCAGCAGATTGTCTTTCTTTATATTGTATCTTTTTTATGTTGCATGTTGCTTTTGGTATCAGCCTGACTCTTTACCCAGTGTATGATAGTTCTGCTGATGTTTTATTGTTTATTGGTGAACATATCTTCATTAAGAGTTTTTGGAAAACTCATCAGACTCAAATGAATAAGTTTTCTTCATAACCCATTTGAAATTATTCCTAATAAAATGATAAAATATGTAA