Transcript asmbl_43965

Sequence
Transcript Sequence for observation asmbl_43965 of TGE0005782:
CCCGCTTCCGGTGCCGCCGTCGCCGTGCGTCCGTGTTGAGTTTCTGTCTTCGCTGAGCCGCTGTAGTCACCGCGGAGATGCCGCTGGAGAACTTGGAGGAGGAGGGTCTGCCCAAGAACCCCGACCTGCGCATCGCGCAGCTGCGCTTCCTGCTCAGCCTACCGGAGCACCGCGGGGACACGGCCGTGCGCGACGAGCTGATGGCGGCCGTCCGCGATAACAACATGGCTCCTTATTATGAAGCCTTGTGCAAATCCCTTGACTGGCAGATGGACATGGACCTGCTCAATAAAATGAAGAAGGCAAATGAAGAAGAGTTGAAACGGTTGGATGAGGAGCTGGAAGATGCAGAGAAAAATCTTGGAGAGAGCGAAATCCGCGATGCAATGATGGCAAAGGCAGAGTACCTCTGCCGGATAGGTGACAAGGAGGGTGCTCTGACAGCCTTTCGCAAGACGTATGACAAAACTGTTGCCCTGGGTCACCGACTGGATATTGTGTTCTATCTCCTTAGGATTGGCTTATTTTATATGGATAATGATCTCATCACACGAAACACAGAAAAGGCCAAAAGCTTAATAGAGGAAGGAGGAGACTGGGACAGAAGAAACCGCCTTAAAGTATATCAAGGTCTTTATTGTGTAGCTATTCGTGATTTCAAACAGGCAGCTGAACTCTTCCTTGACACTGTTTCAACATTTACATCCTATGAGCTCATGGATTATAAAACCTTTGTGACTTATACTGTCTATGTCAGTATGATTGCCTTAGAAAGACCAGATCTCAGGGAAAAGGTTATTAAAGGAGCAGAGATTCTTGAAGTGTTGCACAGTCTTCCAGCAGTTCGGCAGTATTTGTTTTCTCTCTATGAATGTCGTTACTCAGTTTTCTTCCAGTCGTTAGCTGTTGTGGAACAGGAAATGAAAAAGGACTGGCTTTTTGCTCCTCATTATCGGTACTATGTCAGAGAAATGAGAATTCATGCATACAGCCAGCTGCTGGAATCATATAGGTCATTAACCCTGGGCTATATGGCAGAAGCCTTTGGTGTTGGTGTGGAATTCATTGATCAGGAACTCTCCAGATTTATTGCTGCTGGGAGACTACACTGCAAAATAGATAAAGTGAATGAAATAGTGGAAACCAACAGACCTGATAGCAAGAACTGGCAGTACCAAGAAACTATCAAGAAAGGAGATCTGCTGCTAAACAGAGTTCAGAAACTTTCCAGAGTAATTAATATGTAAAACTATGTAAACAAAGGATTTCCTTTAGAGATAATTATTTCGAATTTTTATAGCTTACTCACTATGTGCCCAGTTCACTTGTATAAAATAAATACTGCATCGTTTC