Transcript asmbl_25414

Sequence
Transcript Sequence for observation asmbl_25414 of TGE0004467:
AAGGACTTGAGAGCAGAGATCTTGTTCTCATGGTTCTCTCCCTCCTTCCCTCAGATTTTTGCCAGTATTGCTCCTTCCATCTACGGGCATGAAGACATCAAGAGAGGCCTGGCACTGGCTCTTTTTGGAGGAGAGCCCAAAAACCCAGGGGGCAAGCACAAGGTGCGAGGTGACATCAACGTGCTCTTATGTGGAGATCCTGGCACAGCCAAGTCTCAGTTCCTCAAATACATTGAGAAAGTGTCTAGCCGTGCCATCTTCACCACTGGCCAGGGAGCTTCAGCTGTGGGCCTCACGGCATATGTCCAACGGCACCCTGTCAGCCGGGAGTGGACCTTAGAAGCTGGGGCCCTGGTTCTGGCTGATCGAGGAGTATGTCTTATCGATGAATTTGACAAGATGAATGACCAGGACAGAACTAGCATCCACGAGGCCATGGAGCAGCAGAGTATCTCCATCTCAAAGGCTGGCATTGTCACCTCCTTGCAGGCTCGCTGTACTGTCATTGCTGCTGCCAACCCCATAGGGGGCCGCTATGACCCATCACTGACCTTCTCAGAAAACGTGGACCTCACAGAGCCCATCATTTCCCGCTTTGACATTTTATGTGTGGTGAGGGACACAGTGGACCCAGTACAGGATGAGATGCTGGCCCGTTTTGTGGTTGGCAGCCACATCAGACACCACCCCAGCAACAAGGAGGAGGAGGGGCTGGGCGGCGCCCCAGAGCCTACCATGCCCAACACATATGGCGTGGAGCCTCTGCCGCAGGAGGTCCTGAAGAAGTATATCATCTATGCCAAGGAGAAGGTCCACCCAAAGCTCAACCAGATGGACCAGGACAAGGTGGCCAAGATGTACAGTGATCTGAGGAAAGAATCCATGGCAACAGGCAGCATCCCTATCACAGTGCGGCACATCGAGTCCATGATCCGCATGGCAGAGGCCCACGCGCGCATCCACTTACGGGACTACGTGATAGAGGATGATGTCAACATGGCCATCCGTGTGATGCTGGAGAGCTTCATCGACACACAGAAATTCAGCGTCATGCGCAGCATGCGGAAGACCTTTGCCCGCTACCTTTCATTCCGTCGTGATAACAATGAGCTATTACTCTTCATACTGAAGCAGTTAGTGGCAGAGCAGGTGATGTATCAACGTAATCGCTTTGGAGCCCAGCAGGACATTATTGAAGTGCCTGAGAAGGACTTGGTGGACAAGGCTCGTCAGATCAACATCCACAACCTCTCTGCCTTTTATGACAGTGAGCTCTTTCAGATGAACAAGTTCAGCCATGACCTGAAGCGGAAGATGATCCTCCAGCAGTTCTGAGCCTCCATAGCAGCTCTCTTGATTCTGGCTGGGAAATCAGTTCTGGTGCTCACTTCGCTTTGCTTCAGGGACACAAAATCAAACTGCTGGGGGATACAGTGTGATGGGGGTCAGTGCTGGCAGCTGAACTCTCTGGCTTCCCCCAGTCTCTTGGGCTCAGGCTGTGGCTGGGAATGGTGGAATTTATTTCTTAGGCTCCATTTCTGCTTCTCTCACCATCTTGAGTGGGCATGTTTTGCCAGTGTTTCTTTTTCAACTGCTTGGTAATCCACCATTTCAAGGAAGTTTGCCTCCACTTTGTCCTAGATCGAGTCCTAGGTATTCAAAATACCCACAGTGTTCTAGGTGACTGAGCATATAAGGGTGTTAGGCGAACTATTACCTTCTTGGAGTGAGTTCTGTGTCCTGCCTGCTTCATCTACTTTGGCTGAAGAACACGTTTAAGGTATTGGTAGTGTTTTTCTAAACTCTGCAGATTTTTCTAGCTTTCTATAAATAGAGAAATGATGTGGGCAGAAGAGAGCACAACCCTTCTATGCTCTGTAATGACACAGTTTGGTTTCCTGCAGGAGGAAGGGTTGGAGGGGTTGATCTAGTAATTAGGACGACCCCTCACCATTTCTGTGTTCATCTGTTTTCTCCTACCTAACCATTTCTCCATTCTCTCGTTTTTACATTGTTTCTGTGGTTTAAGTTTTTAATAAAATTAAATAAAATCTAAATA