Transcript asmbl_43084

Sequence
Transcript Sequence for observation asmbl_43084 of TGE0001625:
CTTTGCTACTTTCCGGTCGAAGAGAGTGTTCCTGCTCTGACGTCGGCGGCCCTCCGTGAGGGAGGCAAGACGGCGGAACCGCAGCCATGACTGAGGCTGATGTAAATCCGAAGGCCTACCCTCTCGCAGATGCCCACCTCACCAAGAAACTATTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAAGCCACCAAAACCCTCAACAGAGGCATCTCTGAGTTCATTGTGATGGCTGCAGACGCCGAGCCCCTGGAGATCATTCTGCATCTCCCACTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTCGTGCGCTCCAAGCAGGCCCTGGGGCGGGCTTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCACAGCTGAAGCAGCAGATCCAGTCCATTCAGCAGTCCATCGAAAGGCTCTTAGTCTAAACCGGTGGCCTCTGCCACACTCTCCTACTGACTCCTCCCTCCGGGTTGTGTATCATATTTTCTGTTAGCATGTAGTATTTCCAGCTACTTTCTATTGTTATAAAATATTGTAATACTAAGTCTGGTTTTTACACTTTTGTATTATTTTTGTTTTGTCTTACAGGTCGTCATCTGCCCCCTACCCCTACCCTAATCTTTCTTTCCATTTTCTGCTGTCTTTCCTCCCTTTCAAAAAATGAACTAATGCCCAGAACAGGCAGAAACAGAGTGGTGACACCATTCAAAGGCAGAGAAGAGCCAGGATTGAGATCCACTTCCAGCTTTCAGGCACTAACTCCCTACTGTGTGCAGGACATGATAAAGTAACCACCACCCACTTGGTATCCCTTGTGGCTGGCATACATAATTATTCCATACTTGTTTAAATGATCTGGGGGTTTCCTTTGCTTTCCAGGGGATTATATATCATTTGGGGAGGAAGCATGTATTCTGCGAGGTGGTTCGTTGTGTCATTTGCTAACATGCCACTGCTGTTTCCTTTTGGGAATATGTTATGTTCCCCCCTAACTCCCAGCTGTGCCCCTGAGGGTGACAGGACAGCACCGTACCAGAGAGATATGTGCGCAGAATTCCAGAGGTGGCCTAGGCGAGTGAGTTATGGGGCTTCAAGGAGTCTGGAGGGGCAAGAGAAGAGGCTCAGCTGGTTCTGGAATGCAGGATTCGGGGCAAGTCATGGAGACCTAGAAGCTACAGCAGAGATGATGGGTCCAAGGAGACAGCCTCTGGTGACTGCAGATTTCTTCAGTGGACACTTGGTACCAGCTCTGAGAGCCCTTAACCCTATTTCCTGGGTCAGGTGTATGTTCTTTATCACATCAGAAGGACAGTGCTAATGTGTCATTCTTGTGAGCATCCTAGTAAAGAAATATATTCATAGTCCAATTTAAAGAAAGTGTCATTCTTGGTAGGTATCCAGCTAATACCTGTTTGAAGAACTACTTAGCATTATTAGAGTGGTTTTAGCTTCTCAAACTTTCCACCAAGAAGCTGTGGAAAGCCATTTCCTACCAGATGATTTCCGGTAGTTCAAAATG