Transcript asmbl_25323

Sequence
Transcript Sequence for observation asmbl_25323 of TGE0004463:
GTAAAGCTGCGGCTTCTGCGCTGCCAGGCCCCTTCGAGCTGGCTGGCGGGTTTGTAAAAATGGAATTTCAAGCAGTAGTAATGGCAGTTGGAGGGGGATCTCGGATGACAGACCTGACTTCCAGCATTCCTAAACCTCTGCTTCTTGTTGGGAACAAACCTTTAATTTGGTACCCATTGAACTTGCTTGAGCGTGTTGGATTTGAAGAAGTCATCGTTGTCACAACCAGGGATGTCCAAAAGGCCCTATCTGCAGAATTCAAGATGAAAATGAAGCTAGATATTGTGTGTATTCCTGATGAAGCTGACAAGGGAACTGCAGATTCTTTGCGCCACATATATCCAAAACTTAAGACAGATGTTCTGGTCCTGAGCTGTGATCTGATAACAGATGTTGCCTTACATGAGGTTGTGGACCTGTTCAGAGCTCATGATGCATCACTCGCCATGTTAATGAGAAAAGGCCAAGATGGCTTAGAATCAGTTCCAGGTCAAAAGGGGAAAAAAAAAGCAGTGGAGCAGCGTGACTTCATTGGAGTGGACAGCACAGGAAAGAGGCTGCTCTTCATGGCTAATGAAGCGGACTTGGATGAAGAGCTGGTCATTAAGGGATCCATCCTGCAGAAGCACCCTAGAATACGCTTCCATACAGGCCTTGTGGATGCCCATCTCTACTGCATGAAAAAATATGTTGTGGACTTCCTAATGGAAAATGAGTCAATTACTTCCATTCGAAGTGAACTGATTCCATACCTAGTAAGAAAACAATTCTCTTCAGCTTCCTCACAACAAGGACAAGAAGAAAAAGAGGAAGATCTAAAGAAAAAGGAGCTGAAGTCCTTAGATATTTACAGTTTTATAAAAGAAGCCAATACGCCGACCTTTGCTCCCTATGACACCTGCTGGAATGCCTGTCGAGGAGACAGGTGGGAAGACTTGTCCAGATCACAGGTGCGCTGCTATGTCCACATCATGAAAGAGGGGCTCTGCTGTCGAGTAAGCACCCTGGGACTCTACATAGAAGCAAACAGACAGGTGCCTAAATTGCTACCTCTTCTCTGTCCAGAAGAATCACTGGTCCATATATCAGCCCAGATTGTCAGCAAACACTTGATTGGAGTTGACTGCCTCATTGGGCAAGATACACAGATTGGAGAAAAGTCATCCATTAAGCACTCAGTCATTGGTTCATCCTGTACCATAAGAGATAGAGTGACGATCACCAATTGTCTTCTCATGAATTCAGTCACCGTGGAGGAAGGAAGCAACATCCAGGGCAGCGTAATCTGCAACAATGCTGTGATCGAGAAGGGTGCAGACATTAAAGACTGCCTAATCGGAAGTGGCCAGAGGATTGAAGCCAAAGCCAAACGAGTGAACGAAGTGATCGTGGGTAATGACCAGCTCATGGAGATCTGAGTTCTGAGCAAGTCAGACACCTTCCTCTTGGCCCCCAGAACTACAGATGTTGTCTGTGCCACCTGTGTGACTCTGTATTTATTTCCCAATAAAGAAGGACTCCCAAAGGCA