Transcript asmbl_42560

Sequence
Transcript Sequence for observation asmbl_42560 of TGE0005673:
GGGCTGGGAAGGCGGGTACCCCGAAATCGTCAAAGAGAACAAGCTCTTCGAGCACTACTACCAGGAGCTGAAGATCGTGCCGGAGGGCGAGTGGGACCAGTTCATGGAAGCGCTCAGGGAGCCCCTCCCGGCCACCTTAAGAATTACTGGTTACAAAAGCCACGCGAAAGAGATTCTCCATTGCTTAAAGAACAAGTATTTCAAGGAATTGGAAGACCTGGAGGTGGACGGTCAGAAAGTTGAAGTTCCACAACCCCTGAGTTGGTATCCTGAAGAACTTGCCTGGCACACAAATTTAAGTCGAAAAATCTTGCGAAAGTCTCCACAATTGGAAAAGTTTCACCAGTTTCTGGTTAGCGAAACCGAATCTGGAAACATCAGTCGTCAAGAAGCCGTTAGCATGATTCCACCGCTGTTGCTTAATGCTCATCCTCACCACAAGATCTTAGATATGTGTGCAGCGCCTGGATCGAAGACCACGCAGTTAATCGAAATGCTGCATGCCGACATGAGCGTCCCTTTCCCAGAGGGATTTGTCATCGCGAATGACGTGGACAACAAACGCTGCTATCTGCTCGTCCATCAGGCCAAAAGGCTGAGCAGCCCGTGCATCATGGTGGTCAACCACGACGCGGCCAGCATCCCGAGACTCAGCGTGGACGTGGGCGGGAGGAAGGAGATTCTCTTCTACGATCGCATCTTATGCGACGTCCCCTGCAGTGGAGATGGCACTATGAGAAAAAACATCGATGTTTGGAAAAAGTGGACCACGTTAAACAGCTTGCAGCTGCACGGCTTACAGCTACGCATCGCCACGCGGGGGGCTGAGCAGCTGGTAGAAGGCGGTCGGATGGTTTACTCCACGTGTTCCCTGAACCCTATCGAAGATGAAGCAGTCATAGCATCTTTACTGGAAAAAAGCGAAGGTGCCTTGGAGCTTGCTGACGTGTCTTCTGAGTTGCCGGGACTAAAGTGGATGCCTGGACTCACCCAGTGGAAGGTCATGACAAAAGATGGACAGTGGTTCGCATCGTGGGACGAGGTTCCTCACAGCAGACACACCCAGATCCGTCCCACCATGTTCCCACCGAAGGACGCGAACACGCTGCAGGCCATGCACCTAGAGCGGTGTCTTAGAATATTACCACATCATCAAAATACTGGCGGGTTCTTCGTGGCAGTATTAGTGAAAAAGTCTTCGATGCCATGGAATAAGCGTGCACCAAAGCTGCAGGGAGACTCTGCGGAGCTGAGGGCGCCTGCGCAGTCCAGCCCTGCAGGTCCCACGGGAGGGACAGCTGCGGGTCCCTCCGAGCTGGAAAGGACACCAGTCACTGGAATGGGTGACGCGGAAGTAATTGAAAGAACTGAGAACTTAGACGATAACGGAAACAAGAAAGACGGCGTGTGTGGTCCTCCTCCATCGAAGAAAATGAAGCTGTTTGGATTTAAAGAGGATCCGTTCGTGTTTATTCCTGAAGATGACCCATTATTTCCACCTATCCAGAAATTTTACGCTCTGGACCCTTCGTTCCCGAGGATGAATTTGTTGACGCGAACGACGGAAGGGAAGAAAAGGCAGCTCTACATGGTCTCCAAGGAGCTGCGGAACGTGCTGCTGAACAACAGCGAGCGGGTGAAGGTTATCAACACCGGGATAAAAGTCTGGTGTCGAAACAACAGTGGAGAAGAGTTCGATTGTGCTTTCCGGCTGGCACAGGAGGGAATATATACACTGTATCCATTTATTAACTCAAGAATCATTACTGTGTCGTTGGAAGACGTTAAAATCCTATTAACCCAGGAAAATCCATTTTTTAGAAAACTTAGCAGTGAGACGTACAGCCAAGCCAAGGACCTGGCCAAGGGGAGTGTCGTCCTGAAGTACGAGCCAGACCCCACGTAAGTGAGGATGCCGGAAGTCACATTTTCCTGGGGTGGGGGGTGGACTGTGAGTGGTCTTAGAAGCCTTTTATGACTGTTCCCCTAAAAATAGTACTGGGAAAATTTTGTAAC