Transcript asmbl_42553

Sequence
Transcript Sequence for observation asmbl_42553 of TGE0005670:
AGTGCCCACGGGAGGGGGCTCCGGCCCTTGGCTGCTCACCCGCATCATCGCCCGGTGAAAGTCAGTGAATCGTAGAGCGCTTCTTGCCAAACCAGGAGCTGGAATCACGGTCTCAGTTGACCTCGCTCCCAGAGAAGACACCAAATGACTTATTGTTGTTGTCCTTAGAGCAGTAGTGCAGGCTGAGTGTGTACACGTGTATGTTAGCCGTCTTGCAATTGTATGTAAATGGGGCTTTCGGTTCTTTTGTATTTGGACCTGGAATTGGGCTGGTATCTTAAAATGCAAGGCAGGTCTTGCCGAGAAAGCAAAGCCAGTAGAGTCTTTGTCCTCGGAGGGGGCTCTCCCGGCCACGGGCTCCTCCGAGCCTCCTGGAGGGCAGAGGGGCGCTCCAGGCCCAGAGCTAGGGGCTGGGCGCTTCACTGCCCCTCGGCATCTGCCTGGCAGAGCAGGCGCTCCCTCCCCCCCGTGGTCGTGCTGCCAAGTGAGGCCTTCTCGTTACTGTGGCTCTGATGGTGGGTTTTGCTTGCACGTTCCTTTTCACGGGGGCTGTGGATGGGTGCCAGTCCCCACGCCCCTCACTCTGCCCGTGAGCATTGATCAGCAGCACTTGGGGATTCGCTCGCCAAGCACCGTGCTGGTCCTGTGCTGGTCCCATAGGAAACTAGGGCTCTGGGGACACGGGGACATGGCGGCGTGGGTGCGGGCCCTGCCGATCGACCCCAGGGTTGCGTTTGCCACGCACCACTGACGCCCCTTTCCGTCTCAGCTATGTTCGACCGCGAGAACAAGGCTGGCGTGAACTTCAGCGAGTTCACCGGCGTCTGGAAGTACATCACGGACTGGCAGAACGTCTTCCGCACCTACGACAGAGACAACTCTGGGATGATCGACAAGAACGAGCTCAAGCAAGCACTCTCAGGTTTCGGCTACCGGCTCTCCGACCAGTTCCACGACATCCTCATTCGGAAGTTTGACCGGCAAGGACGGGGGCAGATCGCTTTTGATGACTTCATCCAAGGCTGCATCGTTTTGCAGAGGTTGACAGATATATTCAGACGCTATGATACGGACCAGGATGGCTGGATTCAGGTGTCCTACGAGCAGTACCTTTCCATGGTCTTCAGCATCGTATAACCCAGGACTTCTGCAAACAGCGACGTGATTACGGAAGAGAGACTGAAAATGCCAAACCTCTTACTTTAACAAAATGGAGCACGGACGCATAGACGCTGTTCTTCCTTCAGGGTTCATGTGATTGGTGTTTGGGGACCCAGCTGTACATATGTAGATAATAAGCTGATCGGCGTTTGCACAGTCGTAACGGTGGTCGTGTCGTTACTCAGATGCAAGCATTTGATTTGGGGCTGTTTAATTGTGCCATAAGGTGAGGCCTGAGAATGCTTCAGGTGTTCTGCATGTATAAAATTTATCATGTGCTTTCCTAGATGGTTCTAATTCTGTAGTAGAAATACCTGTATTAACCAATAAGAGTTTTGAATTAATATGTAACTTGCACAGAAGACTTTTCATGTGCCTTACTTTTTAAAAAAAGGGTTTATTGTATTCATTTGAATATGCAGCGTAAGCAATAAAGCAATGTGCCCCTGTCCCATCCGCCTCAGAAGCGCGTGCGGGGTCCGGGGCATGGCTCTGCCTGTGGAGAAGTGTGGGTACCTCCCTTCGCG