Transcript asmbl_42545

Sequence
Transcript Sequence for observation asmbl_42545 of TGE0030397:
GGACACTTCCATCTTCCGAACCTGTCTCCCATCCTGTCTTTTCCCCCCGCATGCACACAGGGCACCTCTGGTATGACAGGCCCGGAGACCCCGCCCACTTTCTAGCCATGGAGGAGACCGGCCGGGAGGCTGTGGCGACCGCGGTGCAGAGGGTGGCCGGGATGCTCCAGCGGCCGGACCAGCTGGACAAAGTGGAGCAGTATCGCAGGCGAGAGGCCCGGAAGAAGGCCTCCGTGGAGGCCAGACTGAAGGCCGCGATCCAGTCGCAGTTGGATGGGGTGCGCGCGGGCCTGAGCCAGCTGCACAGCGCGCTGAACGACGTGAAAGATGTCCAGCAGTCCCTGGCCGACGTCAGCCAGGACTGGCGGCGGAGCATCAATACCATCGAGAGCCTCCGGGACGTGAAGGACGCCGTGGTGCGGCACAGCCAGCTGGCCGCTGCCGTGGAGAACCTCAAGAACATCTTCTCAGTGCCTGAGATTGTGAGGGACACGCAGGACCTCATAGAGCAGGGAGCGCTCCTGCAGGCCCACCGGAAGCTGATGGACCTGGAGTGCTCCCGGGACGGGCTGATGTGTGAGCAGTACCGCATGGACAGCAGGAACACCCGCGACATGACCCTCATCCACAGCTACTTCGGGAGCACGCAGGCTCTCTCTGACGAGCTGGCCAAGCAGCTATGGATGGTCCTGCAGAGGTCGCTGGTCACCGTCCGCCGTGACCCCACCTTGCTGGTGTCCGTTGTCAGGATCATCGAAAGGGAAGAAAAGATTGACAGGCGCATACTCGACCGAAAAAAGCAGACTGGCTTCGTTCCTCCCGGGAGGCCCAAGAGTTGGAAGGAGAAGATGTTTGCCGTCTTGGACAGAACCGTGACCACCAGAATCGAGGGCACACAGGCAGACACCAGGGAGTCCGACAAGATGTGGCTCGTCCGCCACCTGGAGATCATAAGGAAGTATGTCCTGGATGACCTCGTCGTTGCCAAGACCCTGATGGCACAGTGTTTTCCTCCGCATTATGAGATTTTCAGGAACCTCCTGAGCATGTACCACCAGGCGCTGAGCACGCGGATGCAGGAGCTTGCCTCGGAAGACCTGGAAGCGAATGAGATTGTGAGCCTGCTGACGTGGGTCCTGAACACCTACACGAGCGCAGAGATGATGGGGAACATGGAGCTGGCCCCAGAAGTGGACGTCAGCGCCCTGGAGCCTTTGCTGTCTCCACACGTGGTCTCTGAGCTGCTGGACACGTACATGTCGACTCTCACTTCGAACATCATTGCCTGGCTGCGGAAAGCTCTAGAAACAGACAAGAAAGACTGGGTAAAAGAGACGGAGCCAGAAGCCGACCAAGACGGGTACTACCAGACGACGCTCCCGGCCATCGTCTTCCAGATGTTCGAACAGAATCTTCAAGTTGCTGCTCAGATAAGTGAAGATTTGAAAACAAAGGTGCTCGTTTTGTGTCTTCAGCAAATGAATTCTTTCTTAAGTAGGTACAGAGACGAAGCCCAGCTGTACAAGGAGGAGCACCTGAGGGACCGGCAGCGCCCACACTGCTACGTGCAGTACATGGTCGCCATCATCAACAACTGCCAGACCTTCAAAGAATCCATCGTCAGTTTAAAGCGGAAGTATTTAAGAAGCGCAGGCGAAGACGGCGTGTCCGTGAGCCAGCCGAGCATGGACGGCGTCCTGGATGCCATCGCCGACGAGGGCTGCCGCAGCCTGCTGGAGGAGGTCTTCCTGGACCTGGAGCAACATCTCAGTGAGCTGATGACAAAAAAGTGGCTGTCGGGATCGAAGGCTGTAGACATCATCTGCGTCACCGTGGAAGACTATTTCAATGATTTTGCCAAAATCAAAAAGCCATATAAAAAGAGGCTGACGGCCGAGGCGCACCGGCGCGTGGTGGTGGAGTACCTGCGGGCCGTCATGGCGAAGCGCATCTCCTTCCGGAGCCCCGAGGAGCGCAAGGAGGGCGCCGAGCGGATGGTCAGGGAGGCTGAGCAGCTCCGCTTCCTGTTCCGGAAGCTGGCTTCCGGGCTCGGCGAAGAGGCGGATGGGTACTGCGACACGATCACGGCCGTCGCAGAGGTGATAAAGCTGACGGACCCGTCCCTGCTGTACCTGGAGGTCTCGACTCTGGTCAGCAAGTACCCGGACATCAGGGACGAGCACATCGGCGCGCTGCTTGCCATGCGAGGGGACGCCAGTCGGGACATGAAGCAGACCATCATCGAGACGCTGGAGCAGGGCACCACACAGGCGAGTCCGAACTACGTGCCCATCTTCAGGGACATTACGGTCCACAGTCTGAACGTCACCAAGCTCCTCAAATAACTTGTCTCGCCCCGAGTCTGCCCCACCCTCAGCAGTGCGTGACTCTGGAGGCCCAGCGCTCTGGTGGCAGGCCCTGGCCCTGGCCCTGGCCCCCCCCCGGGTCAAGAACGACGTTGCGAGCAGACCCAGGTGCCTGTGCCCCGCGCGCGTCGGCGCTTGTGTAGCTGCTGCTCAATAAAGGCACCGTGGA