Transcript asmbl_41949

Sequence
Transcript Sequence for observation asmbl_41949 of TGE0005638:
CGGAAAAGGTGGGTTTCCGGACGCTGCACCTGCCTGGGTGTAGGTGTAGGTGAGCCGCAGTCTCCGCGAGACCTTCCAGAATTATAAAGCTGTCCTCAGAGATCCGAAAAATGGCAACAAATGAAAATGTCAGCATCTTTAGTTCAGCGTCCTTGGCTGTGGAGTATGTAGATTCACTGTTACCTGAGAATCCTCTGCAAGAGCCATTTAAAAATGCTTGGAACTATATGTTAGATAATTATACAAAGTTCCAGATTGCAACATGGGGATCCCTGATAATTCACGAGGTCATTTATTTCTTGTTCAGTTTACCTGGATTTTTGTTTCAATTTATACCTTACATGAAAAAGTACAAAATTCAGAAGGATAAACCAGAAACATGGGAAGGCCAATGGAAATGCTTTAAAGTACTTCTCTTTAATCACTTTTGTATCCAGTTTCCTTTGATTTGTGGAACTTATTATTTTACAGAGTATTTCAATATTCCTTATGATTGGGAAACAATGCCAAGATGGTATTTGCTTCTGGCAAGATGCTTTGGTTGTGCAGTGATTGAAGATACCTGGCACTATTTCTTACATAGGCTCTTGCACCACAAAAGAATATATAAATATATTCATAAAATTCATCATGAGTTTCAGGCTCCATTTGGAATGGAAGCTGAATATGCACATCCCCTTGAAACGCTAATTCTTGGAACTGGATTTTTCATTGGAATTGTTCTTTTATGTGATCATGTAGTTCTTCTTTGGGCATGGGTGACCATTCGTTTGCTAGAAACTATCGATGTCCACAGTGGTTATGATATTCCTCTCAACCCTCTAAATCTCATCCCATTCTATGCTGGTTCTCGACATCACGATTTTCACCACATGAACTTCATTGGAAACTATGCTTCAACATTCACGTGGTGGGATAGAATTTTTGGAACAGACTCTCAATTTATTGCCTACACTGAAAAGATGAAGAAGATTAAGAAAAAGGCTGAATAAATATCTATGTAAACCTTCCTGAAGAAACACATTTTCCTGGATTAAAAGTAGTAGCTAACATTGCTTCTGGGGAGCAGAAACAAACATGTCTTGGCTGCTAAGTGATGGAAAAAAATTAACAACCTTTATCTTCCTAGTGGGAACTTTTTCTATTTTCCATTCAAGTTCTGTATGTGTAGAAATAAGAAAGGAAGTTTTAAAGGCCGTGTTGCTAACTTTACAAAAAGATTTGTGTAAAGTAAATGGAAAAAGGATTAACCTGTCTGTCCCTACCATTAATACTATAGACCTGAAGTTGAAGTTGGTCTTTAAATCTTAGTGGCCATTTTAACAACTTTTATTAGTGAATGTTGACCTCATCTTGAACTTTAAACGTTTTTTAGAATTTGCCTAAAGATCAAAATATGGGATGAATGACATCAGTTGATACGATGTGAGTGGGGCTGCAAAATCAGGAATAGCCAACACCAAGAATTTCTACTCTTGTCTGGAGCTGACCGATTTGGGGTGATTTTCTTTGAGAAGTCCTTTTGGGTCCCTACTATTGACATCTATAAATTAAAGCAAATCTGAATCGATGTAAGTGGAATATTTTAGTCTAAAGGTTTTCAGGTTTCTTGAATTTTAAATAAATAAATAAATAAACCTTTATTTCTGCCACTTACTGTTTAATATTTGAAAATCAGGTTTTTATTATACTTAAAACTGTATCTTAAAATTTTGTGAACCTACTTGGTGTATTTGCACTTTGAGCTACTGAAATAAATGTGATTTTTTTGCGTCTGGTTATCTGGTCTCCAATTTTGAACATCAG