Transcript asmbl_10895

Sequence
Transcript Sequence for observation asmbl_10895 of TGE0000045:
CGGATGAGAGCGCACGCTTCGGGGTCTCCGGGAAGTCGCGGCGCCTTCGGATGTGGCGGATGCGGCCGTGAGCCGGCGGGGGAGGTGCTGCTGCTGCCTCCACTGTACTCAGACCCAGGTAGCACAGGATTGTCCATCCTCCAGCAGCTCAGTGCAACGGTGTGAACTCAGCCTGTTTCAGAGCCTCCACACCATGACCTCCAAGAAGCTGGTGAACTCGGTGGCTGGCTGTGCTGATGACGCTCTTGCTGGCCTGGTGGCCTGCAACCCCAACCTGCAGCTCCTGCAGGGCCACCGCGTGGCCCTCCGTTCTGACCTGGACAGCCTCAAGGGCCGGGTGGCACTGCTGTCGGGTGGGGGCTCTGGCCATGAGCCTGCCCATGCTGGTTTCATAGGGAAGGGGATGCTGACTGGGGTCATCGCGGGAGCTGTGTTCACCTCCCCGGCAGTGGGCAGCATCCTGGCAGCCATCAGGGCCGTGGCCCAGGCCGGCACAGTGGGGACGCTCCTTATCGTGAAGAACTACACTGGGGATCGGCTCAACTTCGGCCTGGCCCGGGAGCAGGCCCGGGCTGAAGGCATCCCGGTGGAGATGGTGGTGATTGGGGACGACAGCGCCTTCACTGTCCTGAAGAAGGCAGGCCGGCGGGGGCTGTGCGGCACGGTGCTTATACACAAGGTGGCAGGTGCTCTGGCTGAGGCTGGTGTGGGGCTGGAGGAGATCGCAAAGCAGGTGAACGTGGTCGCCAAGGCCATGGGTACCCTGGGGGTGAGCTTATCCTCCTGCAGCGTCCCTGGTTCCAAACCCACCTTCGAGCTCTCAGCCGACGAGGTGGAGCTGGGCCTGGGGATCCACGGGGAAGCTGGTGTGCGCCGGATAAAGATGGCAACCGCCGATGAGATTGTGAAACTCATGCTCGACCACATGACAAACACCACCAACGCGTCCCATGTGCCTGTGCAGCCCGGCTCCTCAGTTGTGATGATGGTCAACAACCTGGGTGGCCTGTCATTCCTGGAACTGGGCATCATAGCCGACGCTACCGTCCGCTCCCTGGAGGGCCGCGGGGTGAAGATTGCCCGTGCCCTGGTGGGCACCTTCATGTCAGCACTGGAGATGCCTGGCATTTCTCTCACCCTCCTGCTGGTGGATGAGCCTCTCCTGAAACTGATAGATGCTGAAACCACTGCAGCAGCCTGGCCTAACGTGGCTGCAGTCTCCATTACTGGGCGGAAGCGGAGCCGGGTAGCCCCTGCCGAGCCCCAGGAGGCCCCTGATTCCACTGCTGCAGGAGGCTCAGCCTCGAAGCGGATGGCGCTGGTGCTGGAACGGGTGTGCAGCACTCTCCTGGGCCTGGAGGAACACCTGAATGCCCTGGACCGGGCTGCTGGTGACGGCGACTGTGGCACCACCCACAGCCGTGCGGCCAGAGCAATCCAGGAGTGGCTGAAGGAGGGCCCACCCCCTGCCAGCCCTGCCCAGCTGCTCTCCAAGTTGTCTGTCCTGCTCCTGGAGAAGATGGGAGGCTCATCTGGGGCGCTCTATGGCCTGTTCCTGACTGCGGCTGCACAGCCCCTGAAGGCCAAGACCAGCCTCCCAGCCTGGTCTGCTGCCATGGATGCCGGCCTGGAAGCCATGCAGAAGTATGGCAAGGCTGCTCCAGGGGACAGGACTATGCTGGATTCTCTGTGGGCAGCGGGGCAGGAGCTCCAAGCCTGGAAGAGCCCAGGAGCTGATCTGTTACAAGTCCTGACCAAAGCAGTCAAGAGTGCCGAAGCTGCAGCCGAGGCCACCAAGAATATGGAAGCTGGAGCCGGAAGAGCCAGTTATATCAGCTCAGCACGGCTGGAGCAGCCAGACCCCGGGGCGGTGGCAGCTGCTGCCATCCTCCGGGCCATCTTGGAGGTCTTGCAGAGCTAGGGTGTGTGACTGCCTCCCTTGGCCTCAGCTCCTCTCACTGCTGTGCTGAGGTGGCCTTTGTCACTTCCTTCTGCCTTCCAACCCTCACCTTCCCCCGGCCTGGCCCCATTGGCCCACCCTCTAAGTTGAGCAGGAAATCCTCCACCAAGCTTCCAGAACTACAGACAGCACCCAGAGTGAGCTGGAGTGGGTCCCCATGCCTCTCCAGCATGCCCTTTCCCTTTGCAGGAGGGTGGAGTCCCTGGGTCATGCCCTCCCCTGCCAGCTCTGGGCTTCAGAGATAAGGCATTTTCCTTGTGCAGCCTTTACCTGGCAATCCTAATTTGGTTTTAAGACTCCCTGTGAAATGCTTTCCGCACCTTAACCCCAGTGAGCGTGAAAAAGAAAGTTAATAAACTATAATACATGGAAGCAAGAAAGACACTGCCTCCTCTGAGGGACCTTTTCCCAAGCATGTAAAC