Transcript asmbl_25158

Sequence
Transcript Sequence for observation asmbl_25158 of TGE0004449:
CTCGGGCACAGTAATGGCAGCGCTGTGAGCAGGGGAACGCGAGTGACAGCCGCCGCCGCCGCCGCCCACCTTCCTCGCCGGGGCCTCGTCCTTCATTCCTTCGGGCTGCCTCCCCTCCCCTTGTCCCCTGCCCCCTGTCCCGCTTCTGCAGAAGATTTCAACACTAAACTTGCACAATGTCTTTGAAACCAAGAGTAGTAGATTTTGATGAAACATGGAACAAACTTTTAACGACAATCAAAGCTGTTGTCATGTTGGAATACGTCGAAAGAGCAACATGGAACGATCGCTTCTCAGATATCTATGCTTTATGTGTGGCCTATCCTGAACCCCTTGGAGAAAGACTTTATACAGAAACTAAAATTTTTTTGGAAAATCACGTACGGCATTTGCACAAGAGAGTTCTGGAATCCGAAGAGCAAGTACTTGTTATGTATCATAGGTATTGGGAGGAATATAGCAAGGGTGCAGACTATATGGACTGCTTGTATAGGTATCTCAACACCCAATTTATTAAAAAGAATAAATTGACAGAAGCTGACCTTCAGTATGGCTATGGTGGTGTAGATATGAATGAACCACTTATGGAAATAGGAGAGCTAGCATTGGATATGTGGAGGAAATTGATGGTTGAACCACTTCAGACCATCCTTATCCGAATGCTGCTCCGAGAAATCAAAAATGATCGTGGTGGAGAAGACCCAAACCAGAAAGTAATCCACGGGGTTATTAACTCCTTTGTTCATGTTGAACAGTATAAGAAAAAATTCCCCTTAAAGTTTTATCAGGAAATCTTTGAGTCTCCCTTTCTGACTGAAACAGGAGAGTATTACAAACAAGAAGCTTCAAATTTATTACAAGAATCAAACTGCTCACAGTATATGGAAAAGGTTCTAGGTAGATTAAAAGATGAAGAAATTCGATGTCGAAAATACTTGCATCCAAGTTCATATACTAAAGTGATTCATGAGTGTCAGCAACGAATGGTAGCAGACCACTTACAGTTCTTACATGCAGAATGTCATAATATCATTCGACAAGAGAAAAAAAATGACATGGCAAATATGTATGTCTTACTCCGTGCTGTGTCCACTGGTTTACCTCATATGATTCAGGAGCTGCAAAACCATATCCATGATGAGGGCCTTAGAGCAACCAGTAATCTTACTCAGGAAAATATGCCAACACTATTTGTGGAGTCAGTTTTGGAAGTACATGGTAAATTTGTTCAACTTATCAACACTGTTTTGAATGGTGATCAGCACTTTATGAGTGCATTGGATAAGGCCCTCACATCAGTTGTAAATTACAGAGAACCCAAGTCTGTTTGCAAAGCTCCTGAATTGCTTGCTAAGTACTGTGACAACTTACTAAAGAAATCAGCGAAGGGGATGACTGAGAATGAAGTGGAAGACAAACTCACCAGCTTCATTACTGTTTTCAAATACATTGATGATAAGGATGTTTTTCAAAAGTTCTACGCAAGAATGCTGGCAAAACGTTTAATTCACGGGTTATCTATGTCTATGGATTCTGAAGAAGCCATGATCAATAAATTAAAGCAAGCCTGTGGTTATGAGTTTACCAGCAAGCTACATCGGATGTATACAGATATGAGTGTCAGTGCTGACCTTAACAATAAGTTCAACAATTTTATCAAAAATCAAGACACTGTTATAGATTTGGGGATTAGTTTTCAAATATATGTTCTACAGGCTGGCGCATGGCCTCTTACTCAGGCTCCTTCATCTACATTTGCAATTCCCCAGGAATTGGAAAAAAGTGTACAGATGTTTGAATTATTTTACAGCCAGCATTTCAGTGGAAGGAAACTTACGTGGTTACATTATCTCTGTACAGGTGAAGTTAAAATGAACTATTTGGGCAAACCATATGTAGCCATGGTTACAACATACCAAATGGCAGTTCTTCTAGCCTTTAACAACAGTGAAACTGTCAGCTATAAAGAGCTTCAAGACAGCACTCAGATGAATGAAAAGGAACTGACAAAAACAATCAAATCATTACTTGATGTGAAAATGATTAACCATGATTCAGAAAAGGAAGATATCGATGCAGAATCTTCATTTTCATTAAATATGAACTTCAGCAGTAAAAGAACAAAATTTAAAATTACTACATCGATGCAGAAAGACACACCACAGGAAATGGAACAGACTAGAAGTGCTGTAGATGAGGACCGGAAAATGTATCTCCAAGCTGCTATAGTTCGTATCATGAAAGCACGAAAAGTACTTCGGCATAATGCTCTTATTCAAGAGGTGATTAGCCAGTCAAGAGCTAGGTTTAATCCTAGTATCAGCATGATTAAGAAGTGTATTGAAGTGCTGATAGACAAACAGTACATTGAACGCAGCCAAGCATCAGCAGATGAATACAGTTACGTAGCGTGATGTCGCTCTCCTCCTGTGTGATGTGAGAAGATCATTGCCATCACCATTTGGCGTGTTCCTGTGGGAAAAAGCAGGCCTGTGCCTCCATAATTTGGTCATTTGGCAGCCCCTGTTTTTCTGCTGTTTACAACATCACCAGTGCCACGTCATGAGCGTCAGAGAAAATGCCTAGAGATATTTCAAGCTCATGTCATTATGACATTTCTTAAAACTTTATTAAAAGAATGAGTGAAGTATTGCTGACATGTGGAAATTTGGTTGGGTACCATGCTTTTTCTCCCCTTCACGTTTGCAGTTGATGTGTTTTTTTTTTAATGTATCTTAAAGGACATAAAATAAAAACTTAAATATTGTAATATGACAGATAACCTTAATAATTGTATCTACATTAAAATGACAAACATGATATTGCTGCTTGTCAAATAAAAAAATAAAGAAGTA