Transcript asmbl_40898

Sequence
Transcript Sequence for observation asmbl_40898 of TGE0005584:
GATCAGTCCAGTGGGACACGAACGGAGATAGTGTACGGGATTGTTCTCTCTGCGGGGCCTCAAGGGAAAAGGAATAGCTATGTCATCCTTGATCAAAAAGGTGATCAGCACCGTGAAAGCCCCAGGGGCCATTGGTCCCTACAGTCAAGCTGTGTTAGTCGACAGGACCATTTACATTTCAGGACAGATAGGCATGGACCCTTCAAGTGGACAACTTGTGCCAGGAGGTGTGGTAGAAGAAGCTAAACAAGCTCTTACAAACATGGGTGAAATTCTGAAAGCTGCAGGCTGTGACTTCACTAATGTGGTAAAAACAACTGTTTTGCTGGCTGACATAAATGACTTTGGTACTGTCAATGAAATCTATAAACAGTATTTCAAAAGTGATTTTCCTGCAAGAGCTGCTTACCAGGTTGCTGCTTTGCCCAAAGGAGGCCGTGTTGAGATTGAAGCAGTAGCTATCCAAGGCCCTCTCACAACAGCATCACTCTAAGCAGGCCTAATAATATTTAGTCTGGAATATTAATAATGTTTTAAAATATATTAATTTTTATAATCAATGTTGGAAAGTATAAGACAGACTAAAATATCTGAAGTATAAAGAAAATACCATATAATAAGGGGACTTGAACATGAATTACAGATGAAATGATGAATCCACTCACTGATGTTATAAAGAACAGTTATGCATGCCCACATGCCTGGATGCGAGAGGAGACACATTGCGTTACGTAGTCACTCAAACAAATAAAAGGAAATAACACTCAGGAAATATGAGTTACTATTCCTGAGAAATAGTGAAGAGTACATGTATTAGTTAAATACTAATAATTTGATGGTGTGAAATATTTAGTTCTCATGTCAAATATGTGATTCTGCTTTTACTTGAGTAAAATTAAAGATTTAAGTTTGAATGGTAGACGTAAAGGCAAAAAAAAGTGGACCAAAATTGTATATAGCTAATATTTTTCTAATGGAAATAAATTAGACTTGCAGATTT