Transcript asmbl_25152

Sequence
Transcript Sequence for observation asmbl_25152 of TGE0004448:
GAGACATGGCCCGGGCAGTGGCTCCTGGAAAAGGAACAAGTGTGGGAAAAGAGAGAGGAAACCGGAGCTAAATGACAGGATGCAGGCGACTTGAGACACAAAAAGAGAAGCGTTGCTCTCGGTTCAAGGCATTGCCTCGCCGCTTTCCTTTCTACAAGACGGACTGAGGATTTTACAGCTCTAGGCGGAGTTGGAGCGCTTCGGATCGTTTAGATTCCCTTCTTTGCTCTGTTTTGCCCGCACGTCCTCATTCTCCCGAGTCTCCCCGTGGATCCGGCGAAGGGAGAATGGAGAGGGGGCTGCCGCTCCTCTGCGCCGCGCTCGCCCTCGCCCTCGCCCTCGCGCCGGCCAGCGCTTTTCGCAACGATAAATGTGGCGATACTATAAAAATTGAAAGTCCCGGGTACCTTACATCTCCTGGTTATCCTCATTCTTATCACCCAAGTGAAAAATGTGAATGGCTGATTCAGGCTCCCGAACCATACCAGAGAATTATGATCAACTTCAACCCTCACTTTGATTTGGAGGACCGAGACTGCAAGTATGACTACGTGGAAGTCATTGATGGAGAAAATGAAAATGGACGTTTATGGGGAAAGTTCTGTGGAAAGATTGCCCCTTCTCCTGTAGTATCTTCAGGACCATTTCTTTTTATCAAATTTGTCTCTGACTATGAGACACATGGTGCAGGATTTTCAATACGTTATGAAATTTTCAAGAGAGGTCCTGAGTGTTCGCAGAACTACACAACCCCTAGCGGAGTGATTAAGTCCCCTGGATTCCCTGAAAAATATCCCAACAGCCTTGAATGCACTTATATTATCTTTGCACCAAAGATGTCAGAGATCATCCTGGAATTTGAAAGCTTTGACCTAGAGCCTGACTCAAATCCTCCAGGGGGAATATTTTGTCGCTATGACCGGCTGGAAATCTGGGATGGATTCCCTGAGGTCGGCCCTCACATTGGCCGTTACTGCGGACAGAAAACACCAGGTCGAATTCGTTCCTCATCGGGCATCCTGTCCATGGTTTTTTATACCGACAGCGCCATAGCAAAGGAAGGCTTCTCGGCCAACTACAGTGTCCTGCAGAGCAGCGTCTCAGAAGATTTCAAATGCATGGAAGCTCTGGGCATGGAATCAGGAGAGATTCATTCTGATCAAATCATAGCTTCTTCCCAGTATAGTATCAACTGGTCTCCAGAACGCTCACGCCTGAATTACCCTGAGAACGGGTGGACTCCCGGAGAAGATTCCTACAGAGAGTGGATACAGGTGGATTTGGGCTTTCTGCGCTTTGTCACTGCCATCGGAACACAGGGAGCCATTTCAAAGGAAACCAAGAAGAAATACTACGTCAAGACGTACAGAATAGATGTCAGCTCCAATGGGGAGGACTGGATCACCCTAAAGGAAGGAAATAGACCTGTTATCTTTCAGGGAAACACCAACCCCACAGATGTTGTGTTTGGAATTTTCCCCAAACCACTGATAACTCGATTTGTCCGAATCAAACCTGTGACGTGGGAAACTGGCATATCTTTGAGGTTTGAAGTGTATGGCTGCAAGATAACAGATTACCCTTGCTCCGGAATGTTGGGCATGGTATCTGGACTTATTTCTGACTCCCAGATTACAGCGTCAAACCAAGGGGAGAGGAGCTGGATGCCTGAAAACATCCGCCTCGTGACCAGTCGCTCTGGCTGGGTACTGCCGCCCGGACCTCAGTCATACATAAATGAGTGGCTCCAAGTGGACCTGGGAGAGGAGAAGATTGTGAGGGGCATCATCATCCAGGGTGGGAAACACCGGGAGAATAAGGTGTCCATGAGGAAATTCAAGATCGGGTATAGCAACAATGGCTCGGACTGGAAAATGATCATGGATGACAGCAAGCGCAAGGCTAAGTCTTTTGAAGGCAACAGCAACTATGATACACCTGAGCTACGAACTTTTCCACCTCTTCCCACACGATTCATCAGGATCTACCCTGAGAGAGCCACTCATGGTGGCCTAGGACTAAGAATGGAGCTACTGGGCTGTGAAGTGGAAGCACCTACAGCTGGACCGACCACTCCCAATGGGAACCTAGTGGATGAGTGTGACGATGACCAGGCCAACTGCCACAGCGGAACAGGTGATGACTTCCAGCTCACAGGTGGTACCACTGTGCTGACCACAGAAAAGCCAACCATGATAGACAGCACAATACAATCAGAATTTCCAACATATGGTTTTAACTGCGAATTTGGCTGGGGTTCTCACAAGACGTTCTGTCACTGGGAACATGACAGTCACGTGCAACTCAAGTGGAGTGTGTTGACCAGCAAAACAGGACCGATTCAAGATCACACAGGAGATGGCAACTTCATCTACTCCCAAGCCGATGAAAACCAGAAGGGCAAAGTGGCTCGCCTGGTGAGCCCTGTGGTGTATTCCCAGAACTCCGCCCACTGCATGACCTTCTGGTACCACATGTCTGGTTCTCATGTGGGCACGCTGAGGGTCAAACTGCGCTACCAGAAGCCAGAGGAGTATGACCAGCTGGTCTGGATGGCCATTGGACACCAAGGAGACCACTGGAAGGAAGGGCGTGTCCTGCTCCACAAGTCTCTGAAACTTTACCAGGTGATTTTCGAGGGCGAAATCGGAAAAGGAAACCTTGGTGGGATTGCAGTGGATGACATCAGTATTAATAACCACATTTCACAAGAGGACTGCATGAACCTAGAATTTCAATGTGGGCTGTGAGCACATCATATGAAATGCATATTCTGGTGCAACAGAGCAAAACTCAGGTCAGTTTACCTTTAGCTATGCCATTACCTAACCCAGTTCATTTAAAATGTCTGGTTGGTACCTACAAAACTATATAATGATGCGGAATCCAAAG