Transcript asmbl_40860

Sequence
Transcript Sequence for observation asmbl_40860 of TGE0005575:
CTGAAAGATGGCGTCTCGCAAGGAAGGCACCGGCTCTGCCACCACCTCTTCCAGCTCCACCACAGGTGCGGCAGGAAAAGGCAAAGGCAAAGGCGGGTCTGGAGATTCGGCCGTCAAGCAAGTGCAGATAGATGGCTTGGTGGTATTAAAGATAATCAAACATTATCAAGAAGAAGGACAAGGAACTGAGGTGGTTCAAGGAGTACTTTTGGGCCTGGTTGTAGAAGATCGGCTTGAAATCACCAACTGCTTTCCTTTCCCGCAGCACACAGAGGACGATGCCGACTTTGACGAAGTCCAGTATCAGATGGAAATGATGCGGAGCCTTCGCCATGTAAACATTGACCACCTCCACGTGGGCTGGTACCAGTCCACCTACTACGGCTCGTTCGTCACCCGGGCACTCCTGGATTCCCAGTTCAGTTACCAGCATGCCATTGAAGAATCTGTCGTTCTCATTTACGATCCCATAAAAACTGCCCAAGGGTCTCTCTCACTGAAGGCATACAGACTGACTCCTAAACTGATGGAAGTTTGTAAAGAGAAGGATTTTTCCCCTGAAGCATTGAAAAAGGGAAGTATCACCTTTGAGCACATGTTTGAAGAAGTGCCGATCGTAATTAAAAATTCACATCTGATCAACGTCCTAATGTGGGAGCTTGAGAAGAAGTCAGCTGTGGCAGATAAACATGAATTGCTCAGTCTTGCTAGCAGCAATCATTTGGGAAAGAATCTACAGTTGCTGATGGACAGAGTGGATGAAATGAGCCAAGATATAGTTAAATATAACACATACATGAGGAACACGAGTAAACAGCAGCAGCAGAAACACCAGTATCAGCAGCGTCGCCAGCAGGAGAATATGCAGCGCCAGAGCCGAGGGGAGCCCCCGCTTCCTGAGGAGGATCTGTCCAAACTCTTCAAGCCTCTGCAGCCTCCAGCCAGGATGGAGTCTCTGCTCATTGCAGGCCAGATTAATACTTACTGCCAGAACATCAAGGAGTTCACTGCCCAAAACTTAGGCAAACTCTTCATGGCCCAGGCGCTTCAAGAATACAACAACTAAGAAAAAGAAGTTTCCAGAAAAGGAGTTAACATGGACTCTTGAGATCACATTGGGGCAACTCTTGGAAGAAATATGTTTGCATACTGAAAAGTCTTTTTAGCCAATAATAAAGTATAAATAAAACA