Transcript asmbl_2503

Sequence
Transcript Sequence for observation asmbl_2503 of TGE0004443:
CTTCATCCAGCCAAAGAGGTGGGTTTGTTGCTTTTTAATTAAACCTTAAAGGTAACTGAACAATTCCAGTCTATATGGTTTAACACTTAAAATTTTTTGTGAAGGTCGAAGTGGTTCTGGAAACTTCGGTGGTGGTCGTGGAGGTGGTTTTGGTGGGAATGACAACTTTGGTCGTGGAGGAAACTTCAGTGGTCGAGGTGGCTTTGGTGGCAGCCGTGGTGGTGGAGGATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGAAGCAATTTTGGAGGGGGCGGAAGCTACAATGATTTTGGCAACTACAACAATCAATCTTCAAATTTTGGACCCATGAAAGGAGGAAATTTTGGAGGCAGAAGCTCTGGCCCCTATGGTGGTGGCGGCCAGTACTTTGCCAAACCACGAAATCAAGGTGGCTATGGTGGTTCCAGCAGCAGCAGTAGCTATGGCAGTGGCAGAAGGTTTTAATTACTACCAGGAAACAAAGCTTAGCAGGAGAGGAGAGCCAGAGAAGTGACAGGGAAGCTACAGGTTACAACAGATTTGTGAACTCAGCCAAGCACAGTGGTGGCAGGGCCTAGCTGCTACAAAGAAGACATGTTTTAGACAATACTCATGTGTACATGGGCAAAAAAACTCGAGGACTGTATTTGTGACTAATTGTATAACAGGTTATTTTAGTTTCTGTTCTGTGGAAAGTGTAAAGCATTCCAACAAAGGGTTTTAATGTAGATTTTTTTTTTGCACCCATGCTGTTGATTGCTAAATGTAATAGTCTGATCATGACGCTGAATAAATGTGTCTTTTTTTAAATGTGCTGTGTAAAGTTAGTCTACTCTGAAGCCATCTTGGTTAATTACCCCAACAGTGTGAAGTTAGATTTCCTTCAGGGTGATGCCAGGTTCCATTTGAAATTTATTTGCAACCTGCTTGGGCACAGAAGCCATTGTCTTCAGAAACCTTGCTTGGTGTAGTTGAATTGACAGTTACTGTGTTGTGACCTGGAGTTCACCATTAAAAGGGTCACCCAAGCAGTCATGGAATTTATTTGGTAATTAATGATTGTTGGCACATCCTATGCAATATATCTAAATTGAATTATGGTACCAGAAAATTATAGATGGGAATGAAGCTTGTGTATCATCCATTATCATGTGTAATCAATAAACGATTTAATATTCTCTTGAATGGAATGACAACTGTATGGATTTGGGACTGGCAGAGCTTTGGACTTTCCCGACCCACTACCCCTGATATGTTCAATGCTTCTATCACAATTCAAGTTCAAAACTCTGCCAGAGAATAGAAACTAGCTGCTGGCTAATGCCACCCTGTAAATCCACAGATTAGAATTATTTGGGAGACCTTTTTAAACATCAATGAGAATTTAACTCCTGACACACAAACAGGTTTACATTAAAGGAAAACTGCAGTGTATTTTGTTCTGGCTGGGTGGGTCTTCATAGAGGTTTATAGCTTAAGCACACTAGTTTCCTAGTTTGGAGATTAAAATTATGGAGATGTCAAGGAGCCATACTTCTTTAAAACTTGCTAACTGCAGTTTTCCTTTAAACATGGCACAAGACCACACGATCATCCTAAAATGTTAATTGTATAGAAAATGATTTCAAACCTTTAACAGTTAATATCCGATCATTGTTGTTTTGTACATAGGTTCTTTTAAGCCCTCCTTTTGATACCCTGAATCTCAGTGCCATTGTACCTACTAGTAGCATAGAGATTTGTTTATCACTAGGACTGTGTATTCCATCCCATGGGTGTGTCGCTTGGAAGTTTGGG