Transcript asmbl_39737

Sequence
Transcript Sequence for observation asmbl_39737 of TGE0005501:
TGGGACTCTATCTGGGACTCAATATTCGGGTGAAAAAGACCCGGGATTCAGTTGAGACGTCTACTGCTGCTTTTGCGTACACTTTCAGGGTGTACCGTCCTCCATCTCCACTGTTTGCCTCTCTCTCCTGTTCCTGTTCCAATCAAGGTATTTTGTCTTGAGCCACCTCCCACCTCTTTATCGAGAAGTGTCACCAGAACCATGGCTGAATACTCCTATGTGAAGTCCACCAAACTCGTGCTCAAAGGAACCAAAGCTAAGAGTAAGAAGAAAAAGAGCAAAGAGAAGAAGAGAAAAAGAGAAGATGATGAAGAAACCCAACTTGATATTGTTGGAATTTGGTGGACAGTAACAAACTTCGGTGAAATTTCAGGAACCATAGCAATTGAAATGGATAAAGGAACCTACATACATGCCCTTGACAATGGACTTTTTACACTGGGAGCTCCACATAAAGAAGTTGATGAAGGCCCTAGTCCTCCAGAGCAGTTTACAGCTGTCAAATTGTCTGATTCTAGAATTGCCCTGAAATCTGGCTATGGAAAATACCTTGGTATAAATTCAGATGGACTTGTTGTTGGGCGTTCAGATGCAATTGGACCAAGAGAACAATGGGAACCGGTCTTTCAAGATGGGAAAATGGCTTTATTGGCCTCAAATAGTTGCTTTATTAGATGCAATGAAGCAGGTGATATAGAAGCAAAAAGTAAAACAGCAGGAGAAGAAGAAATGATAAAGATTAGATCCTGTGCTGAAAGAGAAACTAAGAAAAAAGATGATATTCCTGAAGAAGACAAAGGAAATGTTAAACAGTGTGAAATCAATTATGTGAAGAAATTTCAAAGCTTCCAAGACCACAAACTTAAAATAAGTAAAGAAGACAGTAAAATTCTTAAAAAGGCCCGGAAAGATGGATTTTTGCATGAAACACTTCTGGATAGGAGAGCCAAATTGAAAGCTGATAGATACTGCAAATGACCAGGATTTTT