Transcript asmbl_39343

Sequence
Transcript Sequence for observation asmbl_39343 of TGE0005472:
CGGAAGTTGTACTTATGACGCTGCTTTTCTTCTCCCACAATACCTCGTGCTCGTCCTTTCCAGCTTGGTCCCGGCGGTATGGCTCCCGCGAAGAAGGGTAGCGAGAAGAAGAAGGGCCGTTCTGCCATCAACGAGGTGGTGACCAGAGAATATACCATCAACATTCACAAGCGCATCCATGGAGTGGGTTTCAAGAAGCGTGCTCCTCGGGCACTCAAAGAGATCCGGAAATTCGCCATGAAGGAGATGGGGACTCCAGATGTACGCATCGATACCAGGCTCAACAAGGCCGTCTGGGCCAAAGGGATCAGGAATGTCCCATACCGTATCCGGGTGCGGTTGTCCAGAAAACGTAACGAAGATGAAGATTCACCTAACAAGCTCTATACATTAGTTACCTATGTGCCTGTCACCACTTTCAAAAATCTACAGACAGTTAATGTGGATGAGAACTAACTGCTGATTGTCGAATAAAGATACAAAACTGCCTTTGAGGTTTGGTTTCTCGTTTCTGGTTGCAATGTAATAACTGTGTATCTTAAAGTAGTTCCCAATTATAGAATCACTTGGAAAGCTTTTCCTAAGTACTATGCCTGTGTCCTTTGTCCCCAGCCTCTCGAGTTTCTGAATATTTGGACAGGGCCCAAGCAGTTTTAAGTGATTTTGAAGTGTATGTAGCCTCACTTTAGAATAACTGCTTAGGTAGCTGGGAAAGTGGAGATACATAGGTTAGTTTTTTTTACCTGCATGTTTCGTTAATTCTAAGATAAACATTTTTCCAGAAACTGCCATGTAGAACTCAGCTGCTCTTGGCTTCTTTTCATTTTAAACCAAAATGAGGCAATTGACAGCATCTTAGATTTCATGAAATATATTTGGTAGTATGTCCTTAAGCTTCTGCCTATATCTGTATTGAATGTAACTCTCAAAAGGTATATAATTGTCATCTAAAATAGATTTTTGATGGTGTAAATGCTTAATGATATGCTTAATTTATATGTACAGT