Transcript asmbl_38462

Sequence
Transcript Sequence for observation asmbl_38462 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGTACTTGTCGAGTTTCGGTGTGGCCCCCCTCCCGGTCAGAGCCGAGAGCCCTTCGCAGGAACGTCTGCTTGTGCCAGGAGTGCACTCAAATCCATCGCAGGCTTTTCTCACTTATTCCTCATTTCGGCTCTGAAACATGGCAGGCTTCACACCCATTGTGCAGACGAGGGACAGGTCAGAGAGACTGCCACTTGCCGAGGTCGCTGACTTCTGAGCAGGAGGGCCCACGTGTGACTGGGCTTTCTCTCCACAGAACCCACCAGGTTCTTGTGCTGCGTCCCGAGGCTTCATGTGATTCAGGTGGACATACACTTGGTCACTAGCTTTCCAGTTTTCAGGGGGTTGATTGTTGCCTGGGTTTATTTTAAAATTTAGTTAATCTGGTGTTATTCTCAAAAAGATCTTAAGATAGCTGTGCGGTAGCTTTTGTCCCCCCTTTTCTTAAACCGCTTCTGCGAACGAAATTACGGACCCTTCCTCTTTTTGTTTGCTAAGCTTTCTGGTTTTAGGCATTACGTGGTCAATCCTAGTGAGGAGTAAAGCTGATCAGAAGTTATTCTTAGGGGCTAGAGGAGGCCTGCAGAGGCCTCCGCGCGTGTGGACAGAGCTGTCCGGGACTCTGCATCCACCCTTCAGAGCGGGAAAGTCACTACTTGAGTGTTTCTGGTAGGACCTCCCGTTTGACCCAGTTTCAGTGGACACTAGCGTCAT