Transcript asmbl_38456

Sequence
Transcript Sequence for observation asmbl_38456 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGTGAGTACCTCAGGGACAGGCAGCCCCACTGCTCTGGGCCATGCTGGAGTCTGCAGATGTAGAGCGTGGCCCCAGGTGACGCTGTGCCCCTGGGGACGTGAGCTGAGCTGGAGGCACGCAAGTCCCGAGAAACGCACTCTGCACCACGTCAGTGTCAGAAGCCCAAGCGCCAGTGTCCTCCACACTGCGGTCCCGCAGTTGAGATGAGTCAGGAAGCCAAGGAGCTGCTCCCAGTCGGGGAGGAAGACTTCATGGCAGGCCGCCTCGTCCCCAGGGCTGTCACCTGTTCTGTAGGAAGGGACCTTCTCACTGGGGCGGGGTGAGGGAGCTCCGATGGGGTCGATGCGTTCGGTCCCCACCGTTAGAGAGGACCCCTTCTTGTGCAGGCACCTGGGAAGGGGCTCGGCCTGGGGTCAGCGTGGCAGAGGTGGCAGTGGCTGGGACCCTGGACCGGGCCTCAGGCTCTCCCACTGTGATCCCAGGGGACGGCGGGTGCTGCCCCTTCATGGGATCGGTGCCAGACAGGGAGTGCTTGCCGCGACCTGCCCGTGAGCTGGGAGGTGGAGCGTTTCTTTCCTGGGGGTGGATGGACTCCCTGAGAAAGGGAGCTTTCTCGCCAGAGAGGAATGTAGGACGCCGAAGCAGCTCAAGGCAGAGGAAGGGGAGCTGGGGAGGGCGCAGCTGGCTGCAGAGCTGAGCCGTGTCCTGGTTGGCGGGCGTTAGGCCCCACTGACCCCTTGCCGGGCAACCGACAGTGTCCTGGGTCCTTCCCACTCCACTCTAAGATGAGAGAATTGGGACAGGTGATCTTCAGGGCCGTGGGGGACTCCGGTTCCTGACCCTGCACGGCTGCCTGGTGCGGGCCTGCCTGTGCTTCTGGGGCTCCCTGTGCAGCCTTCTCTTACGGCGTGGCTTTGCCAAGGAGGCCTCCTACCGGAGGGCTGAGCTCAGGACCCCTAGTGGCCCCCTCTCTGCC