Transcript asmbl_38406

Sequence
Transcript Sequence for observation asmbl_38406 of TGE0005420:
AGTGAAGAACAAGAAGCTGCTGCTCCTGGCTGTGTCCGAGTTGTGGCGGTGGCGGTGGCGTGCGGCCGGCGTGGGTGCGTGGCAGGCTGGCCGCAGCAGGGGACGTGTCTGCACTTCTAACCTCTGCCTCCCCGCATTGCTTCTCCTCCTGCAGTATGATTTGACGTCGCGAACATGGACTTTTCTCGGCTCCACATGTACACGCCGCCGCAGTGTGTGCCCGAGAACACTGGCTACACATACGCACTCAGTTCAAGCTATTCTTCCGATGCTCTGGACTTCGAGACTGAGCACAAGTTGGATCCCGTGTTTGATTCTCCAAGAATGTCCCGCCGTAGTTTGCGCCTGGTCACCACAGCGTACACCACCGATGGTGGCCAGGCTGGGGACATTCACTCCTGCGACAGCAGCATGGCCTCCCTGAAGGACAGAGCGGCCAGAGCAGCAAAGCAGCGCAGAGGCGCAGGGAAGCTGGCCTGGAGCGTGAACCACACGTCCGGAAAGGTCGCGGCTGGCCTGCAAGGTGCCGCTGGTCTGCGGCCTCCCGTGCTAGATGCGTCCCTGATCCGCGAGCAGACCAGAGTGGACCACTTCTGGGGTCTTGACGATGACGGAGATGTGAAAGGTGGAAGTAAGGCTGTCACTCAGGGAAATGGCGACGTGGCGGCGGACGCGGCCAGGAGCAACGGCTACACCTGCAGTGACTGCAGCCTGCTGTCCGAGCGCAGGAACACGCTCACCGCGTGCTCTGCCTCCCAGGGGACAGTGTCGCGGATCTACTCGAGGGACAGGAACCAAAAACGCGGCGCGTCTTTCTACACGGATAGGATTTTGTGGCTGGCCAAGTACGTTTCGTCATCTCTTTCATCATTGTTAGTTCAACTTTTTCAAGTGGTTTTAATGAAGCTCAATCGCGAATCAGAAAATTACAAATTGAAAAGTTACGAATCAAAAGATCGTGAATCAGAAAGCTATAACTCAAAAAGCCGTGAATCAAAAGCTCGGCCTGGCGACAGAGGGAGGATGGACGTGAAAGGCGTCCTCGGAGAGGACGGCCACCTCAGGGAGAATGGGGAGTCGTCGTGCGATGACTGTAAGGGGAAGCAGCGCCTTGAGACACAGCCAGCCAGCCACTGGCAGTCTTCCGGGCCATGGAGCGTGGCAGGGACCGTTGGGCACACCTTTTCTCAAGCAGGTCGCTTCTTGACGCAGACCCTGCAGAGGACCCGAGCGGCAGGGTGGTTTGTGTCGGAGACGGTGTTGTCGGTTCTTTGGTTGGCCATGGTGGCTCCAGGGAAGGCAGCCTCTGGAATATTCTGGTGGCTGGGGAGTGGCTGGTACCAGTTTGTTACTTTGATTTCTTGGCTGAATGTGTTTCTTCTTACAAGGTGCCTTCGAAATATTTGCAAGCTTTTAATCTTGCTCATTCCACTGCTGCTTTTACTGGGTGCAGGCCTTTCACTCTGGGGCCAGGGCGGTCCCCTGTCGTTCCTGCCCGCGGTGAACTGGACACACGTGTACAGAGCGCAGAGGGCGGACGGCCCCGGGAGCACCTTCTCGCCTGACGGTCCCCGCCCGAGCCCACCCCTCGAGGCTGGTGATGGGACCGTTGGCTGGCGTCGGATGGGTGAAGTGGAAAGGTGGATGACGTCTTTGTCTGGACAGTGCCAGAGCCACGATGAGCGGCTCAGAGACTTGACAGCCTCGCTTCAGAAGCTGCAGATGCGCGTGGACCAGATGGACGGCGGCAGGGAGGGGGTGTCGTCCTTGGTGAGCCACGTGGTGAGCCAGCGTTTGAAGGAGATGAGTGCCGACGGACTCTTGGGCCCCAAGGCTGACCACGTGACCGCCCACCAAGACCATGGCGCACGCATCGCAAACCTGGAAGATGTTCTCGGAAAACTGACAGAAAAGTCTGAGGTCATCCAGAAGGAGCTAGAACAGACCAAGCAAAGGACAATGAGCGGGCTCGAGGAAGAGCAGCGCCTCCTGTCGGTGGTGAAGCAGCTGCAGCTGGAGCTGAGTCTCCTGAAATCAGAGCTGTCGCAGGGGCAGCATGTGACCCCCAGCTGCGAGCAGGGGGATGCCATCCACGAAAAGGTGGACGCCCGGGTCAGGGAGACGCTCGGGCTCCTGGTGTCGGACGGGCAGTGGGCCGGCGTGCTGGAAGGGCTGCTCCAGAAGCTGTCTTCGCAGTTTGTCGGCAAGGACGACTTACAGGTGTTGTTACGAGACTTGGAGCTGCGGATACTGAAGGAGGTGACCCACCGTGTTTCCGTGACAAAGCAGATCCCCACGTCTGAAACGATCATGTCTGCTGTGAACGACGCCGGGGTTTCTGGAATAACAGAAGCGCAAGCGCACGTCATTGTGAACAATGCATTGAAGCTCTATTCCCAGGACAAGACCGGCATGGTGGACTTTGCTCTGGAGTCCGGCGGCGGCAGCGTCCTGAGCACCCGCTGCTCCGAGACCTACGAGACCAGGACCGCGCTCGTCAGCCTGTTCGGGGTGCCGCTCTGGTACTTCTCCCAGTCGCCCCGCGTCGTGATCCAGCCTGACATGTACCCGGGGAATTGCTGGGCGTTCAGAGGCTCCCAGGGGTACCTGGTGGTGAGGCTGTCCATGAAGATCCACCCAACCAGCTTCGCCCTGGAGCACATCCCAAAGGCACTGTCGCCCACCGGCAACATCAGCAGCGCCCCCAAGGACTTCGCGGTCTACGGACTGGAAAATGAATACGAGGAAGAAGGGGAGCTGCTGGGCCAGTTTGTGTACGATCAGGAAGGGGAGTCGCTCCAGATGTTCCATGCTCCGAAAAGACCCGAACGAGCTTTCCAAATCGTGGAGCTTCGGGTTCTGTCCAACTGGGGCCATCCCGAGTACACGTGTCTCTACCGGTTCAGAGTCCACGGGGAGCCTATCAAGTAGGCCTCTCCTCGCTCCTCTTGTACATTCTGTATATACTGGGACAGCCCGAAACACTGGATCCTCCCTGAACGAGGCGTAGGACGGACAGCATGACGTCGTCTGTTAAATAAACGTTACTGACCGCCAGCAGCAGGACTGGGGATTGAAGCGGCGACGCCGTGCGCCCAGCTGGCCGTTGTGTCCGCGGGAAACACTGCATGTTGAGTGCTCGGGTTTACGGGGGCCGCTGGCAGCGGTGGCTTCGGAAATGCATTTGAATGTATGGTTCGCAAAGACACTTAACTTCGTTTTGGGGATTTGTTTTTAAACATAAAGCTCTTTATACCTGTCTTTCCTTGACGTCAGGAGCAAAGCAAATGAAGTTGAAAGGTTTGAAGTGTTCTCGAAACTTTCACCGGCCCTTTTAAAGGACTTTGAGGGGGTCGGGGGCGGGGGTTACCTTTTCAGTCCAGCATACGTATCTTTCAGGGAGAAACAATGTCACCAAGTTTCAGGGTTCCAAGCTCCTTTCCTTTAGGGTGGGGGTTTTCTTTTATTCAGTACCACTAGTTATTTTAAGTTGCCAGGTGGGGAAACGCCTAAAATGTGTTCTTCTGCTCAGTTTGCTCTACTTCTGAGAAAGATTTGCAAGGTCAGGGCTCAGCGTGCCGCTCTCCATGCGGGACCACGGGGGAGTTCGGTTTCGTTTCATTGCGGGTTGCAGTGGTTCTGACTGGAAGGGGGACAGTCCGGATCCAGACCCCGAGAAAGAGCTCTCAGGTCCGCCAGGCTCATCCCGTTGGGATCGCCCCGGAGTGTCCACTTCACAGCTCGAGTGGGAACTGAGGAATCCAACGGTTGGGTGTTTTCAGGTTGTCTTTTGAATTTGGCTGAAAAGCGAACACTAACGTGCTCCGGATCTCTCAGAGGCTCATGTTTTGAATCCACTGATGCGCTTATCAAAGGGGGACTGGTCAGTGCGGCGAATTCATAGAACCGTTAGGTCTCGTGACCATGACTTTCCTCACAGTGGCACTTTCTACTGGCTCTGGTGGGGATTTGCCTCTTAGGACGACCGTCAACCATTCTCCCTCAAGTCCTGCGAGTCTCATTTAGGTTATAATTAATATTTCATACTGAGACTGTTATACTGAGCAGACTTTATAAATGAGATGTCCACAAGGCACTTAAAGTGTTACAGATGTTTTACCTTAAAATTATTTAAGTTTTATTGGGTTAAGACAGTTTCTTGGTGTACCATAAATCCTGTATTTTTCAGAAAAAAAGATAAAATGATGGTGCTGACTGGTTTTCTGAAGAGTTTTATGTAAATTGCACAACAGTCCTCAAACATACAAAAACTACATAACAGAAAGTAGCATTTTTTCACTTACAATCAGAACTAATGCCTATGCAGTTAAGTTGGATACAATGTACACAGATGTTTCATATATTACGGGATAAATATATAAATCAAAATTTCCTATATTAAACAGTTGGGGAGTTGGGGTGGAAATATTTTGAATATTAATTTATTTTTAAAGATGCAAGATAGGACTTTGTGCAATGTATTTTTGTAAATGCTTTTCAAAATATTTGTCTTTGGTAGTCTTTCTTTTGCTGCCACCAAATTGATAAGATGCTATTGAAATGTTTAAATAAAGAGTTTTAATTTTTAAAAGTGCATGTGAAATTTCAAATGGATAATAAACAGTATATTTCTTTTCTCAAA