Transcript asmbl_38306

Sequence
Transcript Sequence for observation asmbl_38306 of TGE0005409:
CATCTTCCTTCTGTGACTGCATCCTTCTTTTCTGGAAGGAAATCATAAGCAACCTGTCCAGGGAGGATTGCTCCGGAAAATGTTGCAAGAGCCACAAAATGGGGAACCTGCCGAAATTAAGATCATCAAGGAAGCATACAAGAAGGCCTTTTTGTTTGTTAATAAAGGACTGAATACAGATGAATTAGGGCAGAAGGAAGAAGCAAAGAACTACTATAAGCAAGGAATAGGACACCTGCTCAGAGGAATCAGCGTTTCATCAACAGACCCTGAATACACAGGTCCCGAGTGGGAATCTGCTAGGCAGATGCAGCAGAAAATGAAAGAAACACTACAGAATGTACGTACCAGGTTGGAAATTCTAGAGAAGGGTCTTGCCACTTCTCTGCGGAATGATCTTCAGGAGGTGCCCAAGTTATATCCAGAATTTCCACCTAAAGACGTGTCCAAAAAGTCACCGGAGCCTCAGTCCTTTGGTTCACCTCCTCAGCACACTGAAGTAAATGGCAACACCTCAACTTCAAGTACAGGATCGGTTCCTGCGCCTAGTTCTCTATCCATACCATCTCAGAGTCATCCAGCAGAAGCACCTCCTGCTTACACTCCTCAAGCTGCTGAGGGTCACTACACTGTATCCTATGGAACGGAATCTGGGGAGTTTTCATCAGTTGGAGAAGACTTTTATAGAAATCATTCTCAGCCACCTCCTCTTGAGAGCTTAGGGCTAGATGCAGATGAGTTGATTTTGATACCAAATGGAGTACAGATTTTTTTTGTAAATCCTGCAGGAGAGGTTAGTGCACCTTCATATCCCGGGTACCTTAGAATCGTGAGATTCTTAGATAATTCTCTGGATACAGTCCTAAACCGTCCTCCTGGGTTTCTTCAGGTGTGTGGCTGGTTGTATCCTCTAGTTCCTGATAGATCTCCAGTTCTTAAATGTACTGTGGGAGCCTACATGTTTCCTGATACAATGTTGCAAGCATCAGGATGCTTCGTGGGAGTCGTCTTGTCTTCTGAATTACCAGAAGATGATAGAGAACTCTTCGAGGATCTGTTAAGACAAATGTCTGACCTTCGGCTTCAGGCCAACTGGAACCGGGCTGAAGGAGAAAACGAATTCCAAATCCCTGGCAGAGCAAGGAGCCCCTCTGACCAACTGAAGGAAGCCAGTGGCTCCGATGTGAGACAGGTAGGTCCTTCATTGGACCAAGGCAGTAAGGATGTGCGTCATAAAGGAAAATGGGGGAAAAAGGCTAAAGGTACTTCAAGTGAAGAAGTTAATCTGAGTCATATGGTGCCCTATGAGCCAGTTGCAGAAGAAAAAGCAAAGGAACTACCTGAATGGAGTGAGAAAGTGGCTCAAAACATTTTGTCAGGTGCTTCCTGGGTGAGTTGGGGTTTAGTCAAAGGTGCTGAATTTACTGGCAAAGCAATCCAGAAAGGCGCCTCTAAACTCAGAGAACGGATTCAACCAGAAGAAAAACCAGTGGAAGTCAGCCCGGCTGTGTCCAGGGGACTCCATATAGCAAAGCAGGCTACGGGAGGAGCAGCGAAAGTCAGTCAGTTCCTGGTTGACGGAGTTTGCACTGTAGCAAATTGTGTTGGAAAGGAACTAGCCCCACACGTCAAGAAGCATGGAAGCAAACTTGTTCCAGAATCTCTTAAAAAAGACAGAAATGGGAAGTCTCCCCTGGACGGTGCTATGGTCGTAGCAGCAAGTAGTGTTCAAGGATTTTCAACCGTCTGGCAGGGATTGGAATGTGCCGCCAAATGCATTGTTAACAACGTTTCAGCAGAAACAGTACAAACTGTCAGATACAAATACGGGCATACCGCGGGAGAAGCTACACACGATGCAGTAGATTCCGCCATCAATGTTGGTTTAACTGCCTATAACATTGACAACATTGGCATCAAAGCAATGGTGAAGAAAACTGCAAAACAAACCGGACAAACAATCCTTGAGGACTATAAAATACTTGATAATTCAAAGGGGGAGAATCTAGGAGGGGGAGCAAATGTAAACGTGAAAGGGGAGAAGGAGGAGCAGACAGAGGAACTAGAGAAGAAGGAGGCAAAGAAGAAAGGTAAATGATGAAAGGGCAGCGAATCACCTATACCAAAGCCTTAAAAGACGGATGCGACTGTGCTAAGAGGCAGATGTGGAATTCGCCATCGATTAACCAGTATTTTAACAAAGTATACATTTCTACAGAGTAACTGTTTCCATAAGCTTTATGGCATGTATTCTACTTACAAGGAAAATAATTGGTATTCTTTCATCTGGCCTTAGAAATATCCAGTTATATTCTCAGTAAGTTAATTTTTTCTAAATGTGGCTAAAGTATTTTTGCAGTTAAAGTAAGACTAATAATACATGCGCTATAAACCTCATTAAACCCAATATTAAACTATTTTTGTATTTGCTATCTTTCAGAAAGCAAAGTAGGAAATTATTATATATTTACATAATATTGGCATTTAGTAACCTTAGTTTTATTTGTAATGGGAAGGATAATTTAAAATACTGTTTCCTCTTTTTGCACTAATCGTGGATCTTTTTAAGTACTTGTTAGAATTTCCAGCATATAAGCTAAACAAAAATTGTATTCCTAAACTAAGAATTCTCAGATAACATTTAAAAGATGTTTTCAAAACAGGGAATGGTCTAGTCATGAAAAATAAAAAGTTCTATAAAATTATTTAGTAGCTTACCTCTTAGGAAATAGGATGGTCTTTTTGATTTAAAATGAATACAAATAGATTTTTAAGTTTTCTGGATTTAGACTGGCCTGGGGAATTTAGGGGTATGATTCCTATTGTATTAAAATTTGAAGTGACGATTATTTAGTCTATTATATCTACTTCTGTAAGTTTCCCCAAAAGGCTAAAATTTTATGAAAAAATGAGGATAAACAGTATTGAGTTTATGGATAGCAAATATATTTTTATTTTGGAATCAGTCATTGGAATTTTATATATTAAAAAGCCATTAAATTATTAGAAAAGGTTTTATTCATAATATGAAGATGTTAGGCTTACTCCTCGGTGGGTGGGCATAACAGTTTCTACTTTGGCAGAAGGCAGGATATTCACAGACCTTTAAGCTACAAATATGTAGGTAAATACCTGATGGCATTTTATTTTTGTTTACTGGTTTTAAAAGATTGGTATTGGTTTTCATAGCTATTGTCCACCCTAATATTTTTGAATCTCTAGTGGCTACTTAGTTTATTAGACCTTTTTTGAAACTGTCTAAATAATGCACTTTGTGAATGAATGAACTCTCTGAATTACCTGGCTGCAGATACTGTCATAGGCTTGCTTGTATTTTGGGAACACAATAGAATTGGTGGAGTCTTTCTGTAAGGCCAAGGATAATGGACTAGTTGTTAAAACGGAAATAAAATTGAATTGGTAAATA