Transcript asmbl_37876

Sequence
Transcript Sequence for observation asmbl_37876 of TGE0005379:
CCCCCTCCTCGCTCGCTCTCTCCCATCCCCCCAAGCCAGTCGCGCTGCTGCGCAGCTCCCATAGCGGTTACCTCCGCCGGAGACGGTTGGGAGAACCGTTGTGGGCAGGGCTCCACCAGTCAAGAGACTTCTTCCTTACGACTGGACCTCGCAAGCACCGCAGTCGGCGCTGCTGTCGCTCGACAGGGTATCTGAAGTAAAAGGGGCATTTAAATCAAACGGTATTGAGATGGATTGGGTTATGAAACATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTACCATTTGGTTGCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGTATATTGAGATCTTCAGAAGTAGCAGGAGTGAAATCAAAGGATTTTATGATCCACCAAGAAGATTGCTGGGCCAACGACCGGGACCATATGATAGACCAATAGGAGGAAGAGGGGGTTATTATGGAGCTGGGCGTGGAAGTATGTATGACAGAATGCGACGAGGAGGTGATGGATATGATGGTGGTTATGGAGGTTTTGATGACTATGGTGGCTATAATAATTATGGCTATGGAAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATGGGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTTGTACATATGAGAGGATTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGAGTGCATATTGATATTGGGGCTGATGGCAGAGCAACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAAGATGCAGTAGCTGCCATGTCTAAAGATAAGAATAACATGCAACATCGATACATTGAACTCTTCTTGAATTCTACTCCTGGAGGTGGCTCTGGAATGGGAGGTTCTGGAATGGGAGGCTACGGCAGAGATGGAATGGATAATCAGGGAGGTTATGGATCTGTTGGAAGAATGGGAATGGGGAACAATTATAGTGGAGGATATGGTACTCCCGATGGCTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTACGGACAAGGTGGCATGAGTGGAGGTGGATGGCGTGGGATGTATTAAAGCATAACCACCAACCTAAAAGTCCTGACAACAGCATCTGGTCTACTAGACTTTCTTACGGATTTAATTTCTTTTGTATTTTAAGAACTTTATAATGACTGAAGGAATGTGTTTTCAAAATATTATTTGGTAAAGCAACAGATTGTGATGGGAATCTGTTTTCTGTAGGTTTTATTTGTTGCATACTTTGACTTAAAAATAAATTTTTATATTCAAA