Transcript asmbl_37871

Sequence
Transcript Sequence for observation asmbl_37871 of TGE0005377:
GCTTAATGCTGACGGGTTTGAAATGGCTTCGGTGTTAGCTGTGACCCGATTCAGGTGAAGATCTGGTCTTCGCAGTTGCGGCGGCGGCGGCCGCGGAGTCGGAGTTCTTAACGTTCTATCGGATCCGCAGAAGGGCCAGGAGTGGCCGTTTTGGTAGCACGGCGTCCGCAGGCTGGCGACGATCGCTGCTGTAGAAGACAGACAAACGAAGGTTTTTTTCCCCTTTTCATCATGGCTCAGTTTGGAGGACAGAAGAATCCGCCATGGGCTACTCAGTTTACAGCCACTGCGGTATCTCAGCCAGCTGCATTGGGTGTTCAGCAGCCATCACTCCTTGGAGCATCTCCTACCATTTATACACAGCAAACTGCATTGGCAGCAGCAGGCCTTACCACACAAACCCCAACAAACTATCAGTTAACTCAAACTGCAGCACTGCAGCAACAAGCTGCAGCTGCAGCAGCTGCATTGCAACAGCAATATTCACAACCTCAGCAGGCCTTGTATAGTGTGCAGCAACAGTTACAGCAACCTCAGCAGACCCTTTTAACACAGCCAGCTGTTGCACTGCCTACAAGCCTTAGTCTGTCTACTCCTCAGCCTGCAGCACAGATAACTGTATCATATCCAACACCAAGGTCCAGTCAGCAACAAACCCAACCTCAGAAACAGCGTGTTTTTACAGGCGTGGTTACAAAACTACACGATACATTTGGATTCGTGGATGAAGATGTATTCTTTCAACTTAGTGCCGTCAAAGGGAAAACCCCCCAAGTGGGTGACAGGGTATTAGTTGAAGCTACGTATAATCCTAATATGCCTTTTAAGTGGAATGCACAAAGAATTCAAACACTACCAAATCAGAATCAGTCCCAAACCCAACCTTTACTGAAGACTCCTCCTGCTGTACTTCAGCCAATTGCACCACAGACAACATTTGGTGTTCAGGCTCAGCCTCAGCCCCAGTCACTGCTACAGGCACAGATTTCAGCAGCTTCTATTACACCACTGTTGCAGACTCAGCCGCAGCCTTTATTACAGCAGCCACAGCAGAAAGCTGGTTTATTGCAGCCTCCTGTCCGTATAGTTTCACAGCCACAACCGGCACGCCGGTTAGATCCACCATCCAGATTTTCAGGAAGGAATGACAGAGGAGATCAAGTGCCTAACAGAAAAGATGACCGAAGTCGTGAAAGGGAGAGAGAAAGACGTAGATCCAGAGAAAGATCTCCTCAGAGAAAACGTTCCCGGGAGAGATCTCCTCGAAGAGAGAGAGAACGATCACCTCGGAGAGTTCGCCGTGTTGTTCCACGTTACACAGTTCAGTTTTCAAAGTTTTCTTTAGATTGTCCTAGTTGTGACATGATGGAACTAAGGCGCCGTTATCAGAATTTATATATACCTAGTGACTTTTTTGATGCTCAGTTTACATGGGTGGATGCTTTCCCTTTGTCAAGACCATTTCAGCTGGGAAATTACTGCAATTTCTATGTAATGCACAGAGAAGTAGAGTCCTTAGAAAAAAACATGGCCATTCTTGATCCACCAGATGCTGACCACTTATACAGCGCAAAGGTAATGCTGATGGCTAGCCCTAGTATGGAAGATTTGTATCATAAGTCATGTGCTCTTGCTGAAGACCCACAAGAACTTCGAGATGGATTTCAACATCCTGCTAGACTTGTTAAGTTTTTAGTGGGCATGAAAGGCAAGGATGAAGCCATGGCCATTGGAGGCCACTGGTCTCCTTCGTTGGATGGACCAGACCCAGAAAAAGACCCCTCTGTGTTGATTAAGACTGCTATTCGTTGTTGTAAGGCTCTGACAGGCATTGATCTAAGTGTATGCACACAATGGTACCGTTTTGCAGAGATTCGCTACCATCGCCCTGAGGAGACCCACAAGGGGCGTACAGTTCCAGCTCATGTGGAGACAGTGGTTTTATTTTTCCCGGATGTTTGGCATTGCCTTCCCACCCGCTCAGAGTGGGAAACCCTCTCCCGAGGATACAAGCAGCAGCTGGTCGAGAAGCTTCAGGGTGAACGCAAGGAGGCTGATGGAGAACAGGATGAAGAAGAGAAGGATGATGGTGAAGCTAAAGAAATTTCCACTCCTACCCATTGGTCTAAACTTGATCCAAAGACAATGAAGGTAAATGATCTCCGAAAGGAATTAGAAAGTCGAGCCCTTAGTTCCAAAGGGTTAAAATCCCAGTTAATAGCCCGCCTGACAAAACAACTTAAAGTAGAAGAGCAAAAAGAAGAACAAAAGGAATTAGAGAAATCTGAAAAAGAAGATGAAGAGGAGGATGATAGGAAATCTGAAGATGATAAAGAGGAAGAAGAAAGAAAACGTCAAGAAGAAATGGAACGCCAGCGTCGAGAAAGAAGATATATTTTGCCTGACGAACCAGCCATTATTGTACATCCAAATTGGGCTGCAAAAAGTGGCAAGTTTGATTGTAGCATCATGTCTTTGAGTGTACTTTTGGACTACAGATTAGAGGATAATAAAGAACATTCATTTGAGGTGTCATTGTTTGCAGAACTTTTCAATGAAATGCTTCAAAGAGATTTTGGTGTCAGAATATACAAATCATTATTATCTCTTCCTGAGAAAGAGGACAAAAAGGAAAAGGAAAAGAAAAGTAAAAAAGATGAGAGAAAAGATAAAAAAGAAGAAAGAGATGATGAAACTGATGAGCCAAAACCCAAACGGAGAAAATCAGGCGATGATAAAGATAAAAAAGAAGATAGAGATGAAAGGAAGAAAGATGATAAAAGAAAAGATGATTCTAAAGATGATGATGAAACTGAAGAAGATAATAATCAGGATGAGTATGATCCAATGGAAGCTGAAGAAGCTGAGGATGAAGAAGATGATCGAGATGAGGAAGAAATAAACAAACGAGATGACAAAAGAGACATCAACAGGTACTGCAAGGAGAGGCCCTCTAAAGATAAGGAAAAAGAAAAGACTCAGATGATCACAATTAACAGAGATCTGTTAATGGCATTTGTTTATTTTGATCAAAGCCATTGTGGTTACCTTCTTGAAAAGGATTTGGAAGAAATACTTTATACTCTTGGACTACATCTTTCTCGGGCTCAGGTAAAGAAGCTTCTTAATAAAGTAGTACTTCGTGAATCTTGCTTTTACCGTAAACTAACAGACACCTCAAAAGATGAAGAAAACCATGAAGAGTCTGAAGCATTACATGAAGATATGCTAGGAAACAGGTTATTACTTCCAACACCAACAGTGAAACAGGAATCCAAGGATGTGGAAGAAAATGTTGGCCTGATTGTGTATAATGGTGCAATGGTAGATGTAGGAAGCCTCTTGCAAAAATTGGAAAAGAGTGAAAAAGTAAGAGCTGAAGTAGAACAGAAGCTACAGTTACTAGAAGAAAAAACAGATGAAGATGAAAAGACCATATTAAATTTGGAAAATTCCAACAAAAGCCTCTCTGGTGAACTCAGAGAAGTTAAAAAGGACCTTAGTCAGTTACAAGACAACTTAAAGATTTCAGAAAACATGAATTTGCAATTTGAAAACCAACTGAATAAGACAATCAGAAACTTATCCACAGTAATGGATGAAATCCACACTGTTCTCAAGAAGGATAATGTGAAGAGTGACAATAAAGATCAGAAATCCAAGGAGAATGGCGCAAGTGTATAATACACGTAGTGATGAGGAATGGTGTTAAATAATGTAATATAAAAAAATCATGATACAAGAATGTTTGAAAGTGATGCATGTTTGATTTTAGTAGTATAAATATCTGTTAGTTCAAATGATGTATAAAGTTTTATGAATGTGAGAGTCTCTGCTTTTGAAAATTGCTTGTAATTCCTGGCATTGAAATTATAAAACACTCCTTGAGTGAAATAATTTTGCATTGCAAAATGTTTTAGGATGAACTTTGTTATAGTTTTAACCCCAATAAAGTTCATCAGTTTAATTGACAATAGTATTTAATTACCAAATGTCTTTTATTA