Transcript asmbl_24279

Sequence
Transcript Sequence for observation asmbl_24279 of TGE0004427:
GGGCCGGCGCGGCAGGGAGAACGCGGGAGCCAGGGCGACGCTCTGGGCTCTTCTTTCAAAGTTCAACCCGAGCCGCCGCATTTCCCCGCTGCCCCTTGGTCTCAGGAAATTGCACGAACTGTACACCCTGCCTCCTCTCCCGGAGCAGACTTTGGACCTGTCCTCAACGGCCCCGTGCGGATTTCCTGGGCCCATTTGAAATGACGTTCTCGTCTTCCTGATCCCTAGGATCCGTCGACATGAATCCCGTCGTCGTGGTCCACGGCGGCGGAGCCAGCAACATCTCCAAGGACCGCAAAGAGCGGGTGCGCCAGGGCATCATCCGAGCCGCCACCGTGGGTTACAACATCCTCAAGGAGGGAGGGAGCGCAGTTGACGCTGTGGAAGGAGCCGTGACCGTCCTGGAAGATGACCCCGAGTTCAACGCAGGTTGTGGATCTGTCTTGAACGTCAATGGTGAAGTCGAAATGGATGCCAGTATCATGAATGGAAAAGACCTGTCTTCGGGAGCTGTGTCTGCAGTCCGGTGCATCGCAAACCCCATCAAGCTTGCGCGGCTTGTTATGGAAAAGACACCTCATTGCTTCCTGACTGACCAAGGTGCAGCAAAATTTGCTGCAGACATGGGGATTCCAGAAGTTCCCGAGAAGCAACTGATAACAGAGAGAAACATAAAACACCTAGAAAAAGAGAAGAATGAGAAAAGTGCTCAGAAAACAGACCAACAAAAAAACTTGGGAACTGTGGGCGCCGTCGCCTTGGACTCCGAAGGAAACGTGGCTTACGCGACCTCGACGGGGGGCATCGTGAATAAGATGGCCGGCCGAGTCGGGGACACGCCGTGTATAGGATCTGGAGGTTATGCTGACAATGACATTGGAGCCATTTCCACGACGGGGCACGGGGAAAGCATCCTGAAGGTGAATCTGGCCAGACTCACGCTCTTCCACAGAGAACAAGGAAAGACGCTGGAAGAGGCCGCTGACTCGTCGCTGGGTTACATGAAGTCGAAGCTCAAAGGTTTAGGTGGCGTCATCCTGATCAACACAGCAGGAGACTGGGCAGTAAAGTGGACCTCGGCGTCCATGCCCTGGGCCGCCGCCAAGGACGGCAAGCTGCACTCCGGCATTGACCTTGACGAAACCAGTATTGCTGACCTGCCCTAAGCCCCTGGGAGATCGTGTGCTAGGTGCTAGCGTGGAGGCCGGGGTCTGAGCTCCCGCAGATTGTCCTGAGTTTCCGGTCAGTGGACTGACCGCATCCTCCCAGACCTCGTTGCACAGATACCTCCACTTTAAGAATTCTTTCACTTTGTTCACAAAACAAAGAAACCACAACAACCCTCCCTCCCCACCCCATCACCCAGAAATCCCCAAGCAACCAACCAACGAAAACCCAGCTGGTCTCCGTCTCCCTCGTTTCCTTCTAGAGAGTCGCTCTCCTAAATAAATACCTTAAGCTCG