Transcript asmbl_37870

Sequence
Transcript Sequence for observation asmbl_37870 of TGE0005377:
GCTTAATGCTGACGGGTTTGAAATGGCTTCGGTGTTAGCTGTGACCCGATTCAGATCGCTGCTGTAGAAGACAGACAAACGAAGGTTTTTTTCCCCTTTTCATCATGGCTCAGTTTGGAGGACAGAAGAATCCGCCATGGGCTACTCAGTTTACAGCCACTGCGGTATCTCAGCCAGCTGCATTGGGTGTTCAGCAGCCATCACTCCTTGGAGCATCTCCTACCATTTATACACAGCAAACTGCATTGGCAGCAGCAGGCCTTACCACACAAACCCCAACAAACTATCAGTTAACTCAAACTGCAGCACTGCAGCAACAAGCTGCAGCTGCAGCAGCTGCATTGCAACAGCAATATTCACAACCTCAGCAGGCCTTGTATAGTGTGCAGCAACAGTTACAGCAACCTCAGCAGACCCTTTTAACACAGCCAGCTGTTGCACTGCCTACAAGCCTTAGTCTGTCTACTCCTCAGCCTGCAGCACAGATAACTGTATCATATCCAACACCAAGGTCCAGTCAGCAACAAACCCAACCTCAGAAACAGCGTGTTTTTACAGGCGTGGTTACAAAACTACACGATACATTTGGATTCGTGGATGAAGATGTATTCTTTCAACTTAGTGCCGTCAAAGGGAAAACCCCCCAAGTGGGTGACAGGGTATTAGTTGAAGCTACGTATAATCCTAATATGCCTTTTAAGTGGAATGCACAAAGAATTCAAACACTACCAAATCAGAATCAGTCCCAAACCCAACCTTTACTGAAGACTCCTCCTGCTGTACTTCAGCCAATTGCACCACAGACAACATTTGGTGTTCAGGCTCAGCCTCAGCCCCAGTCACTGCTACAGGCACAGATTTCAGCAGCTTCTATTACACCACTGTTGCAGACTCAGCCGCAGCCTTTATTACAGCAGCCACAGCAGAAAGCTGGTTTATTGCAGCCTCCTGTCCGTATAGTTTCACAGCCACAACCGGCACGCCGGTTAGATCCACCATCCAGATTTTCAGGAAGGAATGACAGAGGAGATCAAGTGCCTAACAGAAAAGATGACCGAAGTCGTGAAAGGGAGAGAGAAAGACGTAGATCCAGAGAAAGATCTCCTCAGAGAAAACGTTCCCGGGAGAGATCTCCTCGAAGAGAGAGAGAACGATCACCTCGGAGAGTTCGCCGTGTTGTTCCACGTTACACAGTTCAGTTTTCAAAGTTTTCTTTAGATTGTCCTAGTTGTGACATGATGGAACTAAGGCGCCGTTATCAGAATTTATATATACCTAGTGACTTTTTTGATGCTCAGTTTACATGGGTGGATGCTTTCCCTTTGTCAAGACCATTTCAGCTGGGAAATTACTGCAATTTCTATGTAATGCACAGAGAAGTAGAGTCCTTAGAAAAAAACATGGCCATTCTTGATCCACCAGATGCTGACCACTTATACAGCGCAAAGGTAATGCTGATGGCTAGCCCTAGTATGGAAGATTTGTATCATAAGTCATGTGCTCTTGCTGAAGACCCACAAGAACTTCGAGATGGATTTCAACATCCTGCTAGACTTGTTAAGTTTTTAGTGGGCATGAAAGGCAAGGATGAAGCCATGGCCATTGGAGGCCACTGGTCTCCTTCGTTGGATGGACCAGACCCAGAAAAAGACCCCTCTGTGTTGATTAAGACTGCTATTCGTTGTTGTAAGGCTCTGACAGGCATTGATCTAAGTGTATGCACACAATGGTACCGTTTTGCAGAGATTCGCTACCATCGCCCTGAGGAGACCCACAAGGGGCGTACAGTTCCAGCTCATGTGGAGACAGTGGTTTTATTTTTCCCGGATGTTTGGCATTGCCTTCCCACCCGCTCAGAGTGGGAAACCCTCTCCCGAGGATACAAGCAGCAGCTGGTCGAGAAGCTTCAGGGTGAACGCAAGGAGGCTGATGGAGAACAGGATGAAGAAGAGAAGGATGATGGTGAAGCTAAAGAAATTTCCACTCCTACCCATTGGTCTAAACTTGATCCAAAGACAATGAAGGTAAATGATCTCCGAAAGGAATTAGAAAGTCGAGCCCTTAGTTCCAAAGGGTTAAAATCCCAGTTAATAGCCCGCCTGACAAAACAACTTAAAGTAGAAGAGCAAAAAGAAGAACAAAAGGAATTAGAGAAATCTGAAAAAGAAGATGAAGAGGAGGATGATAGGAAATCTGAAGATGATAAAGAGGAAGAAGAAAGAAAACGTCAAGAAGAAATGGAACGCCAGCGTCGAGAAAGAAGATATATTTTGCCTGACGAACCAGCCATTATTGTACATCCAAATTGGGCTGCAAAAAGTGGCAAGTTTGATTGTAGCATCATGTCTTTGAGTGTACTTTTGGACTACAGATTAGAGGATAATAAAGAACATTCATTTGAGGTGTCATTGTTTGCAGAACTTTTCAATGAAATGCTTCAAAGAGATTTTGGTGTCAGAATATACAAATCATTATTATCTCTTCCTGAGAAAGAGGACAAAAAGGAAAAGGAAAAGAAAAGTAAAAAAGATGAGAGAAAAGATAAAAAAGAAGAAAGAGATGATGAAACTGATGAGCCAAAACCCAAACGGAGAAAATCAGGCGATGATAAAGATAAAAAAGAAGATAGAGATGAAAGGAAGAAAGATGATAAAAGAAAAGATGATTCTAAAGATGATGATGAAACTGAAGAAGATAATAATCAGGATGAGTATGATCCAATGGAAGCTGAAGAAGCTGAGGATGAAGAAGATGATCGAGATGAGGAAGAAATAAACAAACGAGATGACAAAAGAGACATCAACAGGTACTGCAAGGAGAGGCCCTCTAAAGATAAGGAAAAAGAAAAGACTCAGATGATCACAATTAACAGAGATCTGTTAATGGCATTTGTTTATTTTGATCAAAGCCATTGTGGTTACCTTCTTGAAAAGGATTTGGAAGAAATACTTTATACTCTTGGACTACATCTTTCTCGGGCTCAGGTAAAGAAGCTTCTTAATAAAGTAGTACTTCGTGAATCTTGCTTTTACCGTAAACTAACAGACACCTCAAAAGATGAAGAAAACCATGAAGAGTCTGAAGCATTACATGAAGATATGCTAGGAAACAGGTTATTACTTCCAACACCAACAGTGAAACAGGAATCCAAGGATGTGGAAGAAAATGTTGGCCTGATTGTGTATAATGGTGCAATGGTAGATGTAGGAAGCCTCTTGCAAAAATTGGAAAAGAGTGAAAAAGTAAGAGCTGAAGTAGAACAGAAGCTACAGTTACTAGAAGAAAAAACAGATGAAGATGAAAAGACCATATTAAATTTGGAAAATTCCAACAAAAGCCTCTCTGGTGAACTCAGAGAAGTTAAAAAGGACCTTAGTCAGTTACAAGACAACTTAAAGATTTCAGAAAACATGAATTTGCAATTTGAAAACCAACTGAATAAGACAATCAGAAACTTATCCACAGTAATGGATGAAATCCACACTGTTCTCAAGAAGGATAATGTGAAGAGTGACAATAAAGATCAGAAATCCAAGGAGAATGGCGCAAGTGTATAATACACGTAGTGATGAGGAATGGTGTTAAATAATGTAATATAAAAAAATCATGATACAAGAATGTTTGAAAGTGATGCATGTTTGATTTTAGTAGTATAAATATCTGTTAGTTCAAATGATGTATAAAGTTTTATGAATGTGAGAGTCTCTGCTTTTGAAAATTGCTTGTAATTCCTGGCATTGAAATTATAAAACACTCCTTGAGTGAAATAATTTTGCATTGCAAAATGTTTTAGGATGAACTTTGTTATAGTTTTAACCCCAATAAAGTTCATCAGTTTAATTGACAATAGTATTTAATTACCAAATGTCTTTTATTA