Transcript asmbl_24278

Sequence
Transcript Sequence for observation asmbl_24278 of TGE0004427:
GGGCCGGCGCGGCAGGGAGAACGCGGGAGCCAGGGCGACGCTCTGGGCTCTTCTTTCAAAGTTCAACCCGAGCCGCCGCATTTCCCCGCTGCCCCTTGGTCTCAGGAAATTGCACGAACTGTACACCCTGCCTCCTCTCCCGGAGCAGACTTTGGACCTGTCCTCAACGGCCCCGTGCGGATTTCCTGGGCCCATTTGAAATGACGTTCTCGTCTTCCTGATCCCTAGGATCCGTCGACATGAATCCCGTCGTCGTGGTCCACGGCGGCGGAGCCAGCAACATCTCCAAGGACCGCAAAGAGCGGGTGCGCCAGGGCATCATCCGAGCCGCCACCGTGGGTTACAACATCCTCAAGGAGGGAGGGAGCGCAGTTGACGCTGTGGAAGGAGCCGTGACCGTCCTGGAAGATGACCCCGAGTTCAACGCAGGTTGTGGATCTGTCTTGAACGTCAATGGTGAAGTCGAAATGGATGCCAGTATCATGAATGGAAAAGACCTGTCTTCGGGAGCTGTGTCTGCAGTCCGGTGCATCGCAAACCCCATCAAGCTTGCGCGGCTTGTTATGGAAAAGACACCTCATTGCTTCCTGACTGACCAAGGTGCAGCAAAATTTGCTGCAGACATGGGGATTCCAGAAGTTCCCGAGAAGCAACTGATAACAGAGAGAAACATAAAACACCTAGAAAAAGAGAAGAATGAGAAAAGTGCTCAGAAAACAGACCAACAAAAAAACTTGGGAACTGTGGGCGCCGTCGCCTTGGACTCCGAAGGAAACGTGGCTTACGCGACCTCGACGGGGGGCATCGTGAATAAGATGGCCGGCCGAGTCGGGGACACGCCGTGTATAGGATCTGGAGGTTATGCTGACAATGACATTGGAGCCATTTCCACGACGGGGCACGGGGAAAGCATCCTGAAGGTGAATCTGGCCAGACTCACGCTCTTCCACAGAGAACAAGGAAAGACGCTGGAAGAGGCCGCTGACTCGTCGCTGGGTTACATGAAGTCGAAGCTCAAAGGTTTAGGTGGCGTCATCCTGATCAACACAGCAGGAGACTGGGCAGTAAAGTGGACCTCGGCGTCCATGCCCTGGGCCGCCGCCAAGGACGGCAAGCTGCACTCCGGCATTGACCTTGACGAAACCAGTATTGCTGACCTGCCCTAAGCCCCTGGGAGATCGTGTGCTAGGTGCTAGCGTGGAGGTAAAGTGCAGCTTCCTGACGTGGAGACTTAGCTTAACCAATTAGATCTAGAAATGGAAAAAGCCTACAGTCTGTCACTCGTTTCGTTGCCTTGATCAATAAGCACCCGAATGTGTGGCGAGGGGCGGATTCCACAGTGACAGAGAAATCACAGCTGGGGGCCGCCGGGCTTGCTGGCGCCTACGACTCAGGTCGTTCAACGAACCTGCGTTGTGACGACTGAGGTGCCCGTTGCTGGGCTGACCCAAGCCTCATCTCTCCCTGCCCTTTGTTTCCCAAAAGGCCGGGGTCTGAGCTCCCGCAGATTGTCCTGAGTTTCCGGTCAGTGGACTGACCGCATCCTCCCAGACCTCGTTGCACAGATACCTCCACTTTAAGAATTCTTTCACTTTGTTCACAAAACAAAGAAACCACAACAACCCTCCCTCCCCACCCCATCACCCAGAAATCCCCAAGCAACCAACCAACGAAAACCCAGCTGGTCTCCGTCTCCCTCGTTTCCTTCTAGAGAGTCGCTCTCCTAAATAAATACCTTAAGCTCGATGACTGACTCCCATCGCCCTTTTTCTGGCACAATCCCATCCTCGGATGGCCCGAGTCTCAGCCTTGCGCGACCACACGGCTCAGGCGGGCTGGAGGCCATACCCCATAGCGGTCCAAGGGTGGTACCGGACCTTCGAAACGGCCCCCACGCCAGATCGGCCACAGCCGTGGTCCAGGGGTCATCGAC