Transcript asmbl_24277

Sequence
Transcript Sequence for observation asmbl_24277 of TGE0004427:
GGGCCGGCGCGGCAGGGAGAACGCGGGAGCCAGGGCGACGCTCTGGGCTCTTCTTTCAAAGTTCAACCCGAGCCGCCGCATTTCCCCGCTGCCCCTTGGTCTCAGGAAATTGCACGAACTGTACACCCTGCCTCCTCTCCCGGAGCAGACTTTGGACCTGTCCTCAACGGCCCCGTGCGGATTTCCTGGGCCCATTTGAAATGACGTTCTCGTCTTCCTGATCCCTAGGATCCGTCGACATGAATCCCGTCGTCGTGGTCCACGGCGGCGGAGCCAGCAACATCTCCAAGGACCGCAAAGAGCGGGTGCGCCAGGGCATCATCCGAGCCGCCACCGTGGGTTACAACATCCTCAAGGAGGGAGGGAGCGCAGTTGACGCTGTGGAAGGAGCCGTGACCGTCCTGGAAGATGACCCCGAGTTCAACGCAGGTTGTGGATCTGTCTTGAACGTCAATGGTGAAGTCGAAATGGATGCCAGTATCATGAATGGAAAAGACCTGTCTTCGGGAGCTGTGTCTGCAGTCCGGTGCATCGCAAACCCCATCAAGCTTGCGCGGCTTGTTATGGAAAAGACACCTCATTGCTTCCTGACTGACCAAGGTGCAGCAAAATTTGCTGCAGACATGGGGATTCCAGAAGTTCCCGAGAAGCAACTGATAACAGAGAGAAACATAAAACACCTAGAAAAAGAGAAGAATGAGAAAAGTGCTCAGAAAACAGACCAACAAAAAAACTTGGGAACTGTGGGCGCCGTCGCCTTGGACTCCGAAGGAAACGTGGCTTACGCGACCTCGACGGGGGGCATCGTGAATAAGATGGCCGGCCGAGTCGGGGACACGCCGTGTATAGGATCTGGAGGTTATGCTGACAATGACATTGGAGCCATTTCCACGACGGGGCACGGGGAAAGCATCCTGAAGGTGAATCTGGCCAGACTCACGCTCTTCCACAGAGAACAAGGAAAGACGCTGGAAGAGGCCGCTGACTCGTCGCTGGGTTACATGAAGTCGAAGCTCAAAGGTTTAGGTGGCGTCATCCTGATCAACACAGCAGGAGACTGGGCAGTAAAGTGGACCTCGGCGTCCATGCCCTGGGCCGCCGCCAAGGACGGCAAGCTGCACTCCGGCATTGACCTTGACGAAACCAGTATTGCTGACCTGCCCTAAGCCCCTGGGAGATCGTGTGCTAGGTGCTAGCGTGGAGGACTGTCCCCGTCAAACCACTCACAGCAACCGGCCCAGCTGAGAGCGAGGGACAATCCCAGAGGCGAGCGAGGGACAATCCCAGAGGTGCTCCGCGTGCGAAGCAGGAAAGAAGAGGAAGCTTTGACGACTTCGTCCTTCGCATCCTGCTTTCTTTTCCCAGACTGCTATCAGAATGAAGTTGGATTTTCAGACAGGGGGAGGCCTGGGCTGG