Transcript asmbl_37716

Sequence
Transcript Sequence for observation asmbl_37716 of TGE0005343:
CGCGGGTGGAGTGGGCAAGCGAGCGCGAGCAGTGTTAAAGGGAGCTCCCGGCACCGCTCGCAGGTCCAGTTTCCGCAGTGCGCACGCGCAAGGGTATCTTGTCAGTCGGCGCCGCGTGCGGGCCGGTGGCTCTGTAGCAGCGGCGGCGGCTAGTCTCCGGCACCATGAGCGGCTTCAGCAGCGAGGAGCGCGCCGTGCCCTTCACCCTCGAGTACCGAGTCTTCCTAAAAAATGAAAACGGACAATATATATCTCCATTTCATGATATTCCAATTTATGCAGATAAGGATGCGTTCCACATGGTAGTTGAAGTACCACGCTGGTCCAATGCAAAAATGGAGATTGCTACAAAGGACCCTTTAAACCCAATTAAACAAGATGTGAAAAAAGGAAAACTTCGTTATGTTGCAAATTTGTTCCCTTATAAAGGATATATCTGGAACTATGGTGCCATCCCTCAGACTTGGGAATACCCAGGACACAATGACAAACACACTGGCTGTTGTGGCGATAACGACCCAATTGATGTGTGTGAAATTGGAAGCAAGGTATGTGCAAGAGGTGAAATAATCAGGGTGAAAGTTCTAGGCATATTGGCTATGATCGATGAAGGGGAAACTGACTGGAAAGTCATTGCCATTAATGTGGATGATCCTGATGCAGCCAATTATAATGATATTAATGATGTCAAGAGGCTGAAACCTGGCTACCTTGAAGCTACAGTGGACTGGTTTAGAAGGTACAAGGTTCCTGATGGAAAACCAGAGAACCAGTTTGCTTTCAATGCAGAATTTAAAGATAAGGACTTTGCAGTTGATATTATTAAAAGCACTCATGACCTTTGGAGAGCCTTAGTGACGAAGAAAATTGATGGAAAAGGAATCAGTTGCATGAACACCACAGTGTCTGAGAGCCCCTACAAGTGTGATCCTGAGGTGGCCAAAGCCATTGTGGATGCTTTACCACCACCATGTGAATCTGCCTGCACAGTACCAACAGATGTAGATAAGTGGTTCCATCACCAGAAAAACTAAGGAAATTTCTCTGGAATACAAGCTGATACTGCAGCATCCTATTCATCTGGGAGTATTAGATGCAAAAGTAGTGGCTTTTCAAAGCTTTGAATATACAGAACTAATCTAACAAAGCAAATTCTGCTGTGACCAATCCAGTATATTCAGCATGTTATCTAAAAGCATTTTTTCATATCAACTCAGATAACTCTTGGTACATGCTTAAATATCAAAGCAGTTGTAATTTAGAAGTCATTTGTGAATAAATGTGCAAGATAAGTACATATTGGATGTATATGTGTTAGAAATAAAATTATTTTGCTG