Transcript asmbl_37202

Sequence
Transcript Sequence for observation asmbl_37202 of TGE0005318:
CTTCTCTATTTATTGTCGCCGGGAAGCGGCGGCCGCCCCGTACCCGGAACAACAAAGCCCGAAAGACGGAGCCCGAGCCTCGGGGGCTCCTTAGCAACGGGCCGGGGCGGGAGTTCCATGGAGACTGGGGAGCGCGCCCGCCTCATCATCATCCTTGCCCTCCAGCTTATCCTTCGCGTCCGACGCAACCGGCAGCACTGCTGCCGCCGCGTCCTCTGCCACCGCCACCTTTTCCCACGGATGTGATCTTCGTGGTGGGAAGCTAAGTTTTTAAACTACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTCTGATTACAAATGTAGTCTGTGTTTTTAGAACAAGATGTCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGCAAATGTAATTTATAAGCGTGACGTTGGAAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGTTTAGCTCGCAGTCTCCAAAAACTAGGTTTTCAGGTAATATTTACAGATTTTAAGGTTGTTAACGTTTTAGCAGTATGTAACATGCCATTTGAAATCCGTTTGCCAGAATTCACAAAGAACAATAGACCTCATGCCAGTTATGAACCTGAACTTCATCCTGCTGTGTGCTATCGGATAAAATCTCTAAGAGCTACATTACAGATTTTTTCAACAGGAAGTATCACAGTAACAGGGCCCAATGTAAAGGCTGTTGCTACTGCTGTGGAACAGATTTACCCATTTGTGTTTGAAAGCAGGAAAGAAATTTTGTAATTCATCACTTAATTGGTTAGAATCCCTAACTGAGCACCTTTTAAAACCTGCTGCACATTGGACTCAAAACAGAAGGAAAACTGGACCAACAGCAATCGAGGAAATAGACTCTTATTCTTTCATGGCTGCAGTGTAAGCTCCAGGCCCTTTGGGTTTTATTTCAAACCTTGCTGTAATATAAAAAGGAAGTTTACAAGACATGACGTTGCTGCTTTTACAAAAGGACATTCTATTTATTTTTGCAGTAATTCTCATGTCCCCATAAGCAGAGCTGTCACAGTGTGCACTACCTTAAATTGTTTAGTTGTTATTTTTTTCCAGTTTGAGCTAATGTGTTTTATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGGGCACCAAAGAACCTGTAAAAGTTATCTTTTTCAATTGAATGTGCACAAATAAAAGTTTGGAAAAGGTCTCTCTTCATATCCATTCTGTAACTTTTA