Transcript asmbl_24265

Sequence
Transcript Sequence for observation asmbl_24265 of TGE0004423:
TGCATTTCCGGTTGCATTGACGGCTACGCTGCTCGGCAAGGTGTGGATTCCGCTGCCCTCCAGCCTCCACCGGAAAGATGTTCTACCACATCTCCCTGGAGCACGAGATCCTTCTGCATCCGCGCTACTTCGGTCCCAACCTGCTCAACACGGTGAAGCAGAAGCTCTTCACTGAGGTGGAAGGAACCTGCACCGGCAAGTATGGCTTTGTAATTGCTGTCACTACCATCGACAATATTGGTGCTGGTGTGATCCAGCCAGGCCGAGGCTTTGTCCTTTATCCAGTTAAGTACAAGGCCATTGTTTTCCGGCCCTTTAAAGGGGAAGTTGTGGATGCTGTTGTCACTCAGGTCAACAAGGTGAGACCTTATATAGGGGACGCAGTGGGATGGTTCCTCAGAAGATATGGGATAGGTCCCAGCTTCACTCACTAATTCTGTGTTTT