Transcript asmbl_36985

Sequence
Transcript Sequence for observation asmbl_36985 of TGE0005303:
GGGTGACCTGGCCAAGAAGAAGATCTACCCCACCATCTGGTGGCTGTTCCGGGACGGCCTTCTGCCCGAAAACACCTTCATCGTGGGCTATGCCCGCTCACGTCTCACGGTGGCCAATATCCGCCAGCAGAGCGAGCCCTTCTTCAAAGCCACCCCTGAGGAGAAGCCCAAGCTGGAGCAGTTCTTTGCCCGCAACTCCTACGTGGCTGGCCAGTACGACGACGCAGCCTCCTATCAGCGTCTCAATAGCCACATGAACACCCTCAACCAGGGGTCAAAGGCCAACCGCCTCTTCTACCTGGCCTTGCCCCCCACTGTCTATGAGGCTGTCACCAAGAACATCCGAGAGAACTGCATGAGCCAGACAGGCTGGAACCGCATCATTGTGGAGAAGCCCTTTGGGAAGGACCTGCAGAGCTCCGACCAGCTGTCCAACCACATCTCCTCCCTGTTCAGCGAGGACCAGATCTACCGCATCGACCACTACCTGGGCAAGGAGATGGTCCAGAACCTCATGGTGCTGAGGTTTGCCAACAGGATCTTCAGCCCCATCTGGAACCGGGACAACGTTGCCTGCGTCATCCTCACCTTCAAGGAGCCCTTCGGTACTGAGGGCCGTGGGGGCTACTTCGATGAATTTGGGATCATCCGGGATGTAATGCAGAACCACCTCCTGCAGATGCTGTGTCTGGTGGCCATGGAGAAGCCCGCCTCCACTGACTCGGATGATGTCCGAGATGAGAAGGTCAAGGTGTTGAAATGTATCTCAGAGGCAAAGGCGAGCAACGTGGTCCTGGGCCAGTATGTGGGGAACCCCGACGGAGAGGGCGAAGCCACCAAAGGCTACTTGGACGACCCCACAGTGCCCCGTGGGTCCACCACCGCCACCTTTGCAGCTGTGGTCCTCTATGTGGAGAACAAGAGGTGGGACGGGGTGCCCTTTATCCTGCGTTGCGGCAAAGCCCTAAATGAGCGCAAGGCCGAGGTCCGCCTGCAGTTCCGAGACGTGGCTGGCGACATCTTCCAACAGCAGTGCAAGCGCAACGAGCTCGTGATCCGCGTGCAGCCCAACGAGGCTGTGTACACCAAGATGATGACCAAGAAGCCCGGCATGTTCTTCAACCCCGAAGAGTCGGAGCTGGACCTGACCTATGGCAACAGATACAAGAATGTGAAGCTCCCTGACGCGTACGAGCGCCTCATCCTGGACGTCTTCTGTGGGAACCAGATGCATTTTGTGCGCAGTGACGAGCTCCGGGAGGCCTGGCGGATCTTCACACCGCTGCTGCATGAAATCGAGGGCAAGAAGCTCCAGCCCATCCCCTATGTTTACGGCAGCCGAGGCCCGGCGGAGGCAGACGAGCTGATGAAAAGAGTGGGCTTCCAGTACGAGGGCACCTACAAGTGGGTGAACCCCCATAAGCTCTAAGCCCCGGGCGAGCCCACCCCGTCTGTCCGCCCTCCCCACCTTCCCAGCACCTGCCCCCACGTCGAGAAAACTTCGGGACCATAGACCTCAGCCTCGCATTCCTGGCCCCGGGCCCAGCAACATTCCTCTACCACTGAGCACTTGACACTCGTGCTGTGACCGTCCCCAGCCACCACTGGCCCTGTCCGAGCCAGCTTCTGTCCACAGGGCTGAGCCCCAATGGAAGGAAAGAGAAGAATGGCCCTTCTGTCTGTCCCAGGGTCCTTGGCCTAGGACAGGAGTTAAGGGCGAGGGGGAGGACCAGGGGTGGGCTTCAGCGGGCCAGTGGCCAACGCACACACCCAGGGGCTGTGGTCAAGCCCCTCAGAACCTGGGGAAAGGGAGCAAACGTGTCCACACCAGCCTCAGCACTACTGTACATTCCTGGTCACCCACTGAAGGGACTTCTGTGCCGCCAGCAATCCCCTATGTATTGGGCCCTCTGAACGTCCCTCTGCCCCGCCCGCTGCCCCCACCAGCCCAACTCTGCACTCCATGGCCCACCCAACCCACAGGTGCCCCCCTCGCTATTAGAAAAGCAGAAGCAGCAGGTGGGACACCCCACCTCAGCTCCCTGCCATTAAATATGTAAACAGA