Transcript asmbl_36641

Sequence
Transcript Sequence for observation asmbl_36641 of TGE0030212:
CGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGCCTCAGCAACCGGCCTGCCTTCATGCCCTCCGAGGGCAGGATGGTCTCGGACATCAACAATGCCTGGGGCTGCCTGGAGCAGGCAGAGAAGGGCTATGAGGAGTGGCTATTGAACGAGATCCGGAGGCTGGAGCGGCTCGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACGGACGGCAAAGAGGCCATGTTGCGGCAGAAGGATTACGAGACGGCCACGCTTTCGGAGATCAAGGCCCTGCTCAAGAAACACGAGGCCTTTGAGAGTGACCTGGCTGCCCACCAGGACCGCGTGGAGCAGATTGCTGCCATCGCACAGGAGCTCAATGAGCTGGACTATTACGACTCACCCAGTGTCAACGCCCGGTGCCAAAAGATCTGTGACCAGTGGGACAATCTGGGGGCCCTAACCCAGAAGCGGAGGGAAGCCCTGGAGCGGACTGAGAAACTGCTGGAGACCATTGACCAGCTGTACTTGGAGTATGCCAAGCGGGCCGCACCCTTCAATAACTGGATGGAGGGGGCCATGGAGGACCTGCAAGACACCTTCATCGTGCACGCCATTGAGGAAGTCCAGGGACTGACTACAGCCCATGAGCAGTTCAAGGCCACCCTTCCTGATGCCGACAAAGAGCGCCTGGCCATTCTAGGCATCCACAACGAGGTGTCCAAGATTGTCCAGACCTACCACGTCAACATGGCCGGCACCAACCCCTACACAACCATCACGCCTCAAGAGATCAATGGCAAATGGGACCATGTGCGGCAGCTGGTGCCTCGGAGGGACCAGGCCCTGACGGAGGAGCACGCCCGCCAACAGCACAACGAGAGGCTACGCAAGCAGTTTGGGGCTCAGGCTAATGTCATCGGGCCCTGGATCCAGACCAAGATGGAGGAAATTGGGAGGATCTCCATCGAGATGCACGGGACCTTGGAAGACCAGCTCAGCCACCTGCGGCAGTACGAGAAGAGCATCGTCAACTACAAGCCCAAGATTGACCAGCTGGAAGGGGACCACCAGCTCATCCAGGAGGCACTCATCTTTGACAACAAGCACACCAACTACACCATGGAGCACATCCGTGTGGGCTGGGAGCAGCTCCTCACCACCATCGCTCGGACCATCAATGAGGTGGAGAACCAGATCCTGACCCGGGATGCCAAAGGCATCAGCCAGGAGCAGATGAACGAGTTCCGGGCCTCCTTCAATCACTTCGACCGGGTGAGAGATCCACCCCCTGCACTTGCTCAGAGCAGCCCCCAGCCCCTGCCTCTGCCCCAGGGCCCTGGAGGGCATTGCCCAGAGTGTGGGCAGCGATGCTGGACCCAATTCCTGGGCAGGTGAGGAGGAGGAGGAAGGAGAGCGGGGAAGTGCCATCAGCCTGCCCTGAGACTCTGCACCGCACAATACTGGCCTTGGAAAGCCAGTCCTGGTGTCCCATGAGCTTCTCTGCTTTCCTGGAGAGAGAGCTCATATTGTGGGTGGAGAGAAGACCCTTGACCCCTGACCCTTGCTCTCCTACCATGAGTTGTTAGCCCTTGAGAGCAAGGCTGCCATAGCCTCAAGCGAAGGCCTTTTGCCCCTGGCTGTGGGGACTGTCCCTCGCCGCTGCCTCTGGATAGAGAAGCGAAAGTTCCATCCTACCTCCACCCCACCCCTGGGGCAGCCTCTGGGACACTGTGGAGATGTCAGAATTGTCAGCTGGGTTCTCATTCAGCTCTGGGACAGGCTAGGTTTTACATAGGTGCCCCTCTCAGTGCCCTGGGGCTTTGGGGTGACCACCTCGAGTGGGAGGGAGCATGGGGTTAGGTGCTGCC