Transcript asmbl_36640

Sequence
Transcript Sequence for observation asmbl_36640 of TGE0030211:
CGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGCCTCAGCAACCGGCCTGCCTTCATGCCCTCCGAGGGCAGGATGGTCTCGGACATCAACAATGCCTGGGGCTGCCTGGAGCAGGCAGAGAAGGGCTATGAGGAGTGGCTATTGAACGAGATCCGGAGGCTGGAGCGGCTCGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACGGACGGCAAAGAGGCCATGTTGCGGCAGAAGGATTACGAGACGGCCACGCTTTCGGAGATCAAGGCCCTGCTCAAGAAACACGAGGCCTTTGAGAGTGACCTGGCTGCCCACCAGGACCGCGTGGAGCAGATTGCTGCCATCGCACAGGAGCTCAATGAGCTGGACTATTACGACTCACCCAGTGTCAACGCCCGGTGCCAAAAGATCTGTGACCAGTGGGACAATCTGGGGGCCCTAACCCAGAAGCGGAGGGAAGCCCTGGAGCGGACTGAGAAACTGCTGGAGACCATTGACCAGCTGTACTTGGAGTATGCCAAGCGGGCCGCACCCTTCAATAACTGGATGGAGGGGGCCATGGAGGACCTGCAAGACACCTTCATCGTGCACGCCATTGAGGAAGTCCAGGGACTGACTACAGCCCATGAGCAGTTCAAGGCCACCCTTCCTGATGCCGACAAAGAGCGCCTGGCCATTCTAGGCATCCACAACGAGGTGTCCAAGATTGTCCAGACCTACCACGTCAACATGGCCGGCACCAACCCCTACACAACCATCACGCCTCAAGAGATCAATGGCAAATGGGACCATGTGCGGCAGCTGGTGCCTCGGAGGGACCAGGCCCTGACGGAGGAGCACGCCCGCCAACAGCACAACGAGAGGCTACGCAAGCAGTTTGGGGCTCAGGCTAATGTCATCGGGCCCTGGATCCAGACCAAGATGGAGGAAATTGGGAGGATCTCCATCGAGATGCACGGGACCTTGGAAGACCAGCTCAGCCACCTGCGGCAGTACGAGAAGAGCATCGTCAACTACAAGCCCAAGATTGACCAGCTGGAAGGGGACCACCAGCTCATCCAGGAGGCACTCATCTTTGACAACAAGCACACCAACTACACCATGGAGCACATCCGTGTGGGCTGGGAGCAGCTCCTCACCACCATCGCTCGGACCATCAATGAGGTGGAGAACCAGATCCTGACCCGGGATGCCAAAGGCATCAGCCAGGAGCAGATGAACGAGTTCCGGGCCTCCTTCAATCACTTCGACCGGGATCACTCCGGCACGCTGGGTCCCGAGGAGTTCAAAGCCTGCCTCATCAGCTTGGGTTATGATATTGGCAACGACCCCCAGGTACTTGCCTCCTGCATGGAGCACACTCAGGGGTGGCATCTGGGGCGAGAAATAACGCGTTTCTCCTTTTTCTCTTCTCTGTCTGGATCTCCCTGTCCCCCCCTTTCCTGTGGGCCATGGGGCTCGTCCTCTCCTGCTGTCCCTGCCTGGCCCGTGTTGGGCTCCTCCTCCTGCTACTCCGACCTCTGACCCTGCCCTCGGGTATCTTTCGTGGGACCGGCGCGGTGCCTGCCTTCCTCTCTCCTCGCCGTTCTCCATCCCGTGGACGGAATTTTGCATCTCCCTGCTCTGTCTTCCTTTTTCCCGTGGAC