Transcript asmbl_36580

Sequence
Transcript Sequence for observation asmbl_36580 of TGE0005280:
ATGGGAGGGGGCCAGAAGAGCCGGGGAGAGTGAGGCTGCGCAGTTCCAGAGGCGGCAGTGGGCGTTGCGGTTGCTGCGTTCTGGGCCCAGGGAAGGATCGTGTTGGGAGCCGAGTTTTAATTTTGTCTGCAAGGGACCTGGCCTAATAAGAGGCACTCTTGGCAATCTTGTTTATAACATCACCCGGGAATACTAGCCGGGCGTCATGAGTGGCTGTCGGGTATTCATCGGGAGGCTAAATCCAGCGGCCAGGGAGAAAGACGTGGAAAGGTTCTTCAAGGGGTATGGACGAATAAGAGATATCGATCTGAAGAGAGGCTTTGGTTTTGTGGAATTTGAAGATCCCAGGGATGCTGATGATGCTGTATATGAACTTGATGGAAAAGAACTTTGCAGTGAAAGGGTTACTATTGAACATGCTCGGGCTCGATCTCGAGGTGGCAGAGGTAGAGGACGCTACTCTGATCGTTTTAGTAGTCGCAGACCTCGAAATGATAGACGAAATGCTCCTCCTGTAAGAACAGAAAATCGGCTTATAGTTGAAAATTTATCTTCAAGAGTCAGCTGGCAGGATCTTAAAGATTTCATGAGACAAGCTGGGGAAGTAACCTTTGCGGATGCACATCGACCTAAATTAAATGAAGGGGTGGTTGAGTTCGCCTCTTATGGTGATTTAAAGAATGCTATTGAAAAACTTTCTGGAAAGGAAATAAATGGGAGAAAAATTAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCACGAAGCAGGTCTCGTTCCCGGACCAGGAGTTCCTCTAGGTCTCGTAGCCGATCTCGCTCTCGGAGTCGCAAGTCTTACAGCCGGTCTAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTCCTGCACCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCAGAGGTCCAGGTCTCGGTCCCGGTCCAGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTGAATAACTTGCCCTGGGGGCCTTTTTTAAAAAACACACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGGGGAGAAGGGGGGTGGAATTTGGAGGGGGGTTGGGTTGGGCTGGATTATCTTTGTAGATGTGGACCACCAGGGGGTTGTTGAAAACTAATTGTATTAAATTGTCTTTTGATAAGCCTTCTTCTCACATTTTTGTGAATGTCTGAAGTATATAGTTTGTGTATATTGACAGAGCTCTTTTATAACTAAAGCGAATTTAATTTTTTTGTACTAGCAAAAATTTGAACATTTTAGTGCCTGGTTATTCAAATATGTTAATTAAGAATTAGTTTAATGCCTCAATTAAACTAATTAATAGCTTTGGATACTTAAAAGAGCTCTAAATTTGCTTGTACATAGAGGCTTACTGAGTTTTCCTTGTTAGGGTCAAGGGTGTCCTCCCACCTACCCTTTAACAGCTGCTTGGCAAAGACGTTAAAGCAGCTGTTTGTTATTGATAATAAAAGATGATAAAACTGC