Transcript asmbl_24223

Sequence
Transcript Sequence for observation asmbl_24223 of TGE0004418:
TGGAAATTGAAGAACGGAGATGGGGACCAGGAGGGAGGGAAGGACTGGGGGTGAGCAAAGGGGCGGGGCCCTGGCTGCTGTGGCCTCCCCTGACCCCCTCCCCCCGCTGCTGGGGTCCTCGGGCAAGCCCCCTTCTCACTGGACTGAGACATGAGGCTGAACTGGGTCCTGACAATACTGTCCATCTGCCTGAGCGCCCTGGCCACGGCCGCAGGGGCCGAGGGCAAACGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTAGACCACTGTCCCATCAAATCGCGCAAGGGGGACGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAATTTGACAGCAGCCTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTGGGCACGGGCCAGGTCATCAAGGGTTGGGACCAGGGGCTGCTGGGGATGTGTGAAGGGGAAAAGCGGAAGCTGGTGATTCCATCAGAGTTGGGATATGGAGAGCGGGGAGCCCCGCCAAAGATTCCAGGTGGTGCAACCCTGGTGTTCGAGGTGGAACTGCTCAAAATCGAGCGACGTTCAGAACTGTAGCAAAGCTGGGGAGGGGCAGCGGAGAGGCCATCAGGGACCAGACTGTTTAAAAGAAAAACAAAAACAAACTTAAAGCTTA