Transcript asmbl_24195

Sequence
Transcript Sequence for observation asmbl_24195 of TGE0004412:
GTCGGTGGGCATGATAGCCAATAGGAGCAGGGAGAGGGGTCCCGGGACTGAAAACGGCTGCCGGAGGGGGCTACGGGGATCATGGGCCTTTTGACCATCCTGAAGAAGATGAAGCAGAAAGAGCGGGAGCTGCGACTGCTCATGCTTGGCCTGGACAATGCTGGCAAAACAACCATCCTCAAGAAGTTCAATGGAGAGGACATCGACACCATCTCTCCAACGCTGGGCTTCAACATCAAGACCCTGGAGCACCGGGGATTCAAGCTGAACATATGGGATGTGGGCGGCCAGAAGTCCCTGCGCTCCTACTGGCGAAACTACTTTGAGAGCACGGATGGCCTCATCTGGGTGGTGGACAGCGCTGACCGCCAGCGCATGCAGGATTGCCAGCGCGAGCTCCAGAGCCTGTTGGTGGAGGAGCGCCTGGCCGGAGCCACCCTCCTCGTCTTTGCCAACAAGCAGGACCTTCCCGGAGCACTGTCCTCTAATGCCATCCGTGAGGCCCTGGAGCTGGACTCCATCCACAGCCACCACTGGTGCATCCAGGGCTGCAGCGCCGTCACTGGGGAGAACCTGCTGCCCGGCATTGACTGGCTCCTGGATGACATTTCCAGCCGCATCTTCACGGCCGACTGAGCCGCTCCAGACGCCCCGACATCACAGTCTGGGTCGTCCCTTCTACCCCCTGGCCCTCACCAAGCACCATCCGTGGGAGGATGGGAATCAGCCAGCCCAACTAACACTCCCCAACCCCTCCGTAACCTGCTGCCGCCGCCCGCTGCTGCTCCGTGGCCAGCCAGCTCCCATGACAGGAGGGCTGCCCTCCTGGCTGTCACCCTGGCTCCTGACCTGGCCCTGCAGCTGCCATACCAAGAGGTGAGGGTTGGGGCTGGGCGGGGGCTGTCTCTGCTGCTATGGAGGCTGTGGGCCTCGTCCTTTGCTCAGCTGTAAGAATAAACAGTTCCTTGCCCCTA