Transcript asmbl_35318

Sequence
Transcript Sequence for observation asmbl_35318 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGTGACGACTTACTCCCGGCAGGGACTGAGGATTACATCCATATAAGAATCCAGCAACGGAACGGCAGGAAGACACTGACCACTGTTCAGGGCATCGCAGATGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGTAATGGTACTGTGATTGAACATCCTGAATACGGAGAGGTTATTCAGCTTCAAGGTGACCAAAGAAAAAACATTTGCCAATTTCTGTTGGAGGTTGGCATTGTCAAGGAGGAACAGCTTAAGGTTCATGGATTCTAAAATGAACCTAGATACGTGGAGAATTTCTTGAATAATTTTGTTCTCTAAATCCAGTTTGGCTGCCTTGTGAAATGATTCTCTGCAGTAAACGGACTTTTCATTTATTTAATCATTCAGATTTCCATTTACATCTGCATGACTACAGAAAACATGGGGTATGTAGGCTAGTAACACATAAGAAAATTGCAGTAAGATGGTAATGAAACCCCGTATTCATCTTAACATGTTTCCAATGGAAAATATTTTGTTTTGAGTGTTTATTTGTTTATTGTTCAGTTTATTACTTTTCACTTGATTAAATGTTTTTTTGTTGTATTAAACCATGTATGTTGCAGCTTAACAATAAAAATATGAATTCTTTTGTGAGCAGTTAGGCTCCCAAATTTAAGCAAGTAAGATACCCATACATTTTGTCTTTCATAATTGGAGTTCTCATTCTGAAAGTATTCTAATTAGATTCAGCTGCTGTTAAACCCAAAGCTAGAAGAGAACCTTTGTTAAAAGTAGCTTGTGTTCTTCATTTACTGACTTAAAATAAGAATAGAATCGCGTATAAACTCAGCTAGAGCCAAGAATCTGTCACAGTGTTAAATTTTAAAAAATAATGTGAAGTATAATTTAAACTTAAGTATTAGCACATAGAATTATTTTCTGTGTCTTTATTGGTTATGTCACTGGGCTGCCAAAATAAGTCTATCCCTAAGTGCCAGATAATGTAATAGACTTTCAACATAAATAAATTTAGTCACAGGCACTGCTTTGCAAGTGTGGGTGACGATGCCACCCTACAGCTGGAAGATACTGGGGTTCAAGTTAACTTCCCTTGAGTGCTAGAAAGTGACAGTTGGGATGCCAGCCCAGGGCTTCCAGCCAGAAAAGCCATGTTCTTTCACTACATCCTGGTGTCAGTGTGTGTTTCACCGAAGGAAGTGAGAGCCGCGGGTGGTGGTGCATAGCGGCTGGGTGTTGTGTGAGAAAGAGGATTTGCAGTTCTTAGCTCTGAGATCTTTGCAGCGCATCTTTTTGAGTTCCAAACTCACGCTTTTTATTGAGCAGTAATCAAGATGTGTCATTAAAGCCATTTAGCCAAGATGAAGAAATGCATCCACAAGTGCATACTTTTCAGCCGCTGCAGCGGCACGATGGCAGTGTGACAGCGTCTCGCTGTGCACCAGTGCAGTCTGTACCAGCTGAGCCCGGGCCCCTATTCTGATAAAACTGCTTTTGGAAAAACAGACTCAGCCCCCACAGATTTACCTCTTAAAGACACTTAAGTAATCGGTTTTGTTACTTTCTTACCCCATCCTACCTCTAATCAAGAAAGACAGACAGACTTAAGTGACTATACCATAATAGAGTGTCAAATTTGGTAAGCTCATTTCTGGAAAAGCATAAATTTGACTAAGAAGATCAAGAAGTTTGGGAGAATTCTCCAACTTAACCGAGAAATCCTCGTTTTTCTACCTGTAACATTTTGTAATGATTCCACCTCTGGTTGAGAGGTGCTGTGGAAATAGTTTATGAAAATGACAAAGCAGAGACTTAACGTTAATGTGTAAAGTGTTGCCTCTTTGTCTACTGAGGGCCAAGCTAATGCCCAGCAAAGAACTGTCTAAGATGAGGGTTGAACAAAGAAGATAGACAAGGGAAGCCTCAAAAATGGGAAGGAAAAGCCCCCTCACCTTGGCACCCGTAGCCGAGCAGTTGGTCATCGCTTCGTGTGTCAGGCCACTCCCATTGGATGGGATCTAAAGCTTTGAGCAAAGCTGGTTTTTGTGAGGAGCGCCTCCTGATCCTTCAGCCTGTGCATCCCAGACACATGGCTGGACTTGTCACCTGTAGGGCAGACCCCATCCTTACAGCAAGAACAGATCATGTACCCTTCTTTCTTGTCTTTGAA