Transcript asmbl_24179

Sequence
Transcript Sequence for observation asmbl_24179 of TGE0004410:
GGAGGGAGGAGGGCGGAGGGGCCGCAGGAGGAGGGCGGGGAGGAGCGCTCTTCCTGGTTGGGCCCTGCCCTGAGCTGCCACCCGGGAAGCCAGCCTCAGGGACCGCAGCGATCCCCTAAACACTCCTCCAGGATGGCTGAGGAGTTTATCACCCCTGTGTACTGCACCGGGGTGTCTGCACAAGTGCAGAAGCTGCGGGCCAAGGAGCTGGGCCTGGGCCGCCATGAAAACGCTATCAAGTACCTGGGCCAGGATTACGAACAGCTGCGGGCTCAGTGTCTGCAGAGTGGGACCCTCTTCCGGGATGATGCCTTCCCCCCAGTGCCCCAGAGCCTGGGCTACAAGGACCTGGGCCCCAACTCCTCCAAAATCTATGGCATCAAGTGGAAGCGTCCCACGGAGCTGCTCTCCAACCCCCAGTTCATCGTGGATGGAGCCACCCGCACAGACATCTGCCAGGGAGCACTGGGGGACTGCTGGCTCCTGGCTGCCATCGCCTCTCTTACCCTCAATGACACCCTCCTGCACCGAGTGGTTCCGCATGGCCAAAGCTTCCAGGATGGCTACGCTGGCATCTTCCATTTCCAGCTGTGGCAGTTTGGGGAGTGGGTGGACGTCGTCGTGGATGACCTGCTGCCCATCAAGGACGGGAAGCTGGTGTTCGTGCACTCTGCCCAAGGCAATGAGTTCTGGAGCGCCCTGCTCGAGAAGGCCTATGCCAAGGTAAATGGCAGCTACGAGGCCCTATCAGGTGGCAGCACCTCGGAGGGCTTTGAGGACTTCACAGGCGGTGTCACCGAGTGGTATGAGCTGCGCAAGGCGCCCAGCGACCTCTACCAAATCATCCTCAAGGCGCTGGAGCGGGGCTCCTTGCTGGGCTGCTCCATTGACATCTCCAGTGTTCTAGACATGGAAGCCGTCACCTTCAAGAAGCTGGTGAAGGGCCACGCTTATTCTGTGACTGGGGCCAAGCAGGTGAACTACCAGGGCCAGATGGTGAGCCTGATCCGGATGCGGAACCCGTGGGGCGAGGTGGAGTGGACAGGAGCCTGGAGTGACCGCTCCTCGGAGTGGAACAATGTGGACCCTTATGAACGCGAGCAGCTCCGGATCAAGATGGAGGACGGGGAGTTCTGGATGTCATTCCGAGACTTCATGCGCGAGTTCACCCGCCTGGAGATCTGCAACCTGACGCCCGACGCCCTCAAGAGCCGGACTTTCCGCAAATGGAACACCACCCTCTACGATGGCACCTGGCGGCGGGGGAGCACCGCGGGGGGCTGCCGGAACTACCCAGCCACTTTCTGGGTGAACCCTCAGTTCAAGATCAGGCTGGAGGAGACGGATGACGCAGACGATGACTACGGGGGTCGCGAGTCGGGCTGCAGCTTCGTGCTCGCCCTCATGCAGAAGCACCGCCGCCGCGAGCGCCGCTTTGGCCGCGACATGGAGACCATCGGCTTCGCGGTCTACGAGGTCCCTCCGGAGCTGGCAGGCCAGCCGGCCGTGCACCTGAAGCGGGACTTCTTCCTGGCCAACGCATCCCGTGCCCGATCGGAGCAGTTCATCAACCTGCGGGAGGTCAGCACCCGCTTCCGCCTGCCGCCCGGGGAGTACGTGGTGGTGCCCTCCACCTTCGAGCCCAACAAGGAGGGCGACTTCGTGCTGCGCTTCTTCTCGGAGAAGAGCGCCGGGACCGAGGAGCTGGACGACCAGGTGCAGGCCAATCTTCCTGATGAGCAAGTGCTCTCGGAAGAGGAGATTGATGAGAACTTCAAGGCCCTCTTCAGACAACTGGCAGGGGAGGACCTGGAGATCAGCGTCAAGGAGCTGCAGACCATCCTCAACAGGATCATCAGCAAACACAAAGACCTGCGCACCAAGGGCTTCAGCCTGGAGTCCTGCCGCAGCATGGTGAACCTCATGGATCGGGACGGCAATGGGAAGCTGGGCCTGGTGGAGTTCAACATCCTGTGGAACCGTATCAGGAATTATCTGTCCATCTTCCGGAAGTTCGACTTGGACAAGTCAGGCAGCATGAGTGCCTACGAGATGCGGATGGCCATTGAGTCTGCAGGCTTCAAGCTCAACAAGAAGCTGTATGAGCTCATTATCACGCGGTACTCGGAGCCCGACCTGGCTGTGGACTTTGACAACTTTGTATGCTGCCTAGTGCGGCTGGAGACCATGTTCCGGTTCTTCAAAACTCTGGACACAGATCTGGATGGAGTTGTGACCTTTGACCTGTTTAAGTGGTTGCAGCTGACCATGTTTGCATGAGGCGGGGCTCAGGCCCCCTGCTGTGTCCCTTTTCCTTCCTCATCCGCCAAACCATGCCAGGCCACACCAGCTGCAAGTGCCTTCCTCGGAGCGGGAGGTGGCCCCGTCCTCCCGTCCCCTCACCTCCCAGCCGCTACAGTTCATCTGCCTCGGGCAGAGCTGTGTGGCCCTCGCTGCTCTGCCACCCATGGGCTCAGATGACCTCCCCCGGCCTCTCCCACCGCCAAGCCAGGAAGGCAGCTTTCGCTCGTTCCTGCCTCAGGATGGGGCTTCAGCGGGAGCTGCCAGCCCCGGGCTCCCAGCATCCCGATGTGTCTTCTCCCCTCACTCCAGAGGCTGCCCACCTGGCCTCGCCTGCGGACTTCAAACCATAACCACTAAGCTCTGCAGTCTGTATTGTAACATGCAGAGCCCCCTCCCAGCTGGGGCCCCCTCCCCTGCTGGGAACGCCTGTCCCTTCCTGTGCAGAAGCCAATGCCCTTCTCTGCCCTGTGACCTGGCCCCTGGCCCCGCCCTGCCTGCCGACCAGGAGCTGCCCGGCCTGGGGGATGGTCAGGCCTTTCCTCCCCACTCCCTCCCTCCTTTTTTATATTGGTGATTTTAAAGGGGACTCTTCAGAGACTGGGGTACCAGTTATGGGGGTGCACCTGGGTCTTTGGTGGGTAGTCTCATGTTTTCATGCAGAGGAACCCCAAATAATAAAGGAAACGGCCCCA