Transcript asmbl_24175

Sequence
Transcript Sequence for observation asmbl_24175 of TGE0004407:
ATAACAATATGATTCATTTAATACCACTGACATGTTAAAGTGGCTAAGATGGTAAATTTTGTGTTATATATATTTTGACACAATAAAAGAATTGTAAGGAAAATGCCATAACCAAATCTCACTTTGATCAGTTCCTGCCACTTTCCTCTCGTTGCTCATGTGCACTGCTAGTGACGTGCCTGACACGTGTTCCAGTTGTTTGCGTACCTGCCTGTCTGCACCAGCTGACGGGATTCTCTGAAGATGGGGATGAGGTCTCCTCATCTTGGATTCCCAGAGTCGCACACAGAAGACTCTCAATCTGACCTCTGAGGCATTTTCCCTAACTGTCCTTTCTCCCACCATCCCAGTATCTTCTAATCAACGCCTTACGGTCCTTTCTATCTTAGACTTTGAGCAGAACATGGTCCTGGTGGCCTGTGGACCATACACCACGTCTGACAGCATCACATATGACCCCCTGCTCGACCTGATCACCATCATCAACCACGACCAGCCAGACATCTGCATCCTGTTTGGCCCTTTCCTGGATGCTAAGCATGAACAGGTTGAGAACTGTCTGCTGACGAGTTCGTTCGAAGATGTTTTCAAGCAGTGTCTACGAACAATTGTCGAAGGGACTCGAAGCTCCGGCTCCCACCTCGTCTTTGTCCCGTCGCTGAGAGATGTCCAGCACGAGCCCGTGTACCCACAGCCACCTTTCAGCTACTCCGACCTGCCTCATGAGGACAGGAAGCGAGTGCAGTTCGTGTCTGACCCCTGCAGCCTCTCCGTGAATGGTGTGGTCCTTGGCCTGACGTCCACGGATCTGCTGTTCCACATGGGGGCCGAGGAGATCAGCAGTTCTTCTGGAACTTCAGACAGATTCAGCCGAATACTGAAGCACATCCTGACCCAGAGGAGCTACTACCCGCTCTACCCTCCCCAGGAAGACATGGCCATTGACTACGAGAGTTTCTGCGCCTACGCACAGCTGCCCGTCACCCCGGATGTCTTCATAGTCCCGTCAGAGCTGAGGTACTTCGTGAAGGACGTCCTTGGCTGTGTCTGCGTGAATCCTGGACGCCTCACCAAAGGGCAGGTGGGGGGCACCTATGGCCGGCTCTACCTCAGGAGGCAGACCCCAGAGGCCGGGGAGGGGAGGCGGAGTCCATGTGTTGCTGCCCAGGTGGTCAGGATCTGAGCCTTCAGGCACTTTGTCCCCCACTGTGCGGGCCTGGAGGCCCTAGGACCCAGGACTATCTGACAAGATTCCGCCCCGTTGGAAGGTGAAGAAGAGGAGGCGGCCACAGCTGGGGCGTGGAGGCCGCGGGGGCGGGCCCAGCACAGAAGACATCATGCAGCCGTCTCGGACTTCGAGTGAGCTCCATTGGAAGAACGCCTTTGCTCCTGATACACGGATTATAACGTGAACTGCCTGTGGATGCAGCACACTTGGAAAAAGCGAGAAGGCTTTATGACCTTCTACACGAATAAGACAACTTTTGGAGAAATAAAAGTAAATTCTGAGTGTAA