Transcript asmbl_24173

Sequence
Transcript Sequence for observation asmbl_24173 of TGE0004408:
CGCGCATGCGCGCGCTGCACAAACCATTTGGCGGGATTTTCCCGGCGGCCGTGTTCTACTGGGGTCTTTGGGATGCTTAGCGTTGGAGGCTTCCCCCACATTGTTTTAAAAAGTGTTTCTCCGTGACTGACCGCTGGGGCTTTCTGACCGCCTGAGGTCTTGGGCTATTTGGTCACCTTCCTTCTCGGTCCCCCAGAGGGCAAAAGGACCAGAGTGACCTCCTGCTGATCGATCTCCACACCCGAGGGTTTCTTGGACTCAGGTCGGAGCTGTGTGGACCCGCCCCCACTCCTGTGTCACCATGTCCGTGTCCACCCAGCAGCTGGCCGAGGAGATGCAGATCTTCGGCCTAGAGTACGAGGAGCCTCTGATTGAGAAATTGGCGGAGCTGTGCGTTCTGCATGGAGAGAATGAGGCGGGAATGGTAGGCGAGCTCATAGCCTTCTGCACCAGCACGCAGAAAGATCGCCTCACCGCAGAGACCCTGAACTCTTTTGAGCATGAGGTTCTGAGCAAAAGATTGGCCAGATCCCGGCACAGTGCCTCCAAGGACAGTGGGCACGCGGGAGCTAGAGACATCATTTCCATACAAGAGCTAATCGAAGTGGAGGAGGAAGAGGAGACCCTTCTGAATGCCTATTCCACACCCTCCAAGGGTTCTCAGAAGCGAGCTGTCACCACCCCAGAAACCCCCCTAACCAAAAGGAGAGTGTCTGCTCGCAGCCCCCACCAGCTCCTCTCACCATCGAGTTTCTCTCCAAGTGCTACTCCCTCTCAGAAATACAACTCGAGGAATAACCGAGGAGAAGTGGTTACCTCCTTCGGCTCGGCCCAGGGAGTGTCTTGGTCCGGGAGAGGAGGAGCCGGCATCATCAGCCTAAAGGTCTTGGGGTGTCCAGAGTCACTAACCGGGAGCTACAAATCAATGTTTCAGAAGCTGCCAGACATTCGAGAAGTTCTGACCTGTAAGGTAGAAGAACTTGGCAGTGAACTCAAGGAACATTACCAGATCGAGGCTTTTGCTCCTGTTCTAGTTCCAGCACAAGAGCCCGTCACTCTGCTGGGCCAGATTGGCTGTGATAGCAACGGGAAGCTGAACAACAAGTCGGTGATTCTAGAGGGGGACCGGGAGCATTCTTCCGGCGCTCAAGTTCCAGTGGATTTATCTGAGCTCAGAGAATACTCTCTGTTTCCTGGACAGGTTGTAATTATGGAAGGAATGAACACGACTGGTAGAAAACTCGTTGCCACTAAACTCTATGAGGGTGTGCCACTTCCATTTTATCAGCCCACCGAAGAGGAGGGAGACTTTGAGCAGAACATGGTCCTGGTGGCCTGTGGACCATACACCACGTCTGACAGCATCACATATGACCCCCTGCTCGACCTGATCACCATCATCAACCACGACCAGCCAGACATCTGCATCCTGTTTGGCCCTTTCCTGGATGCTAAGCATGAACAGGTTGAGAACTGTCTGCTGACGAGTTCGTTCGAAGATGTTTTCAAGCAGTGTCTACGAACAATTGTCGAAGGGACTCGAAGGTCAGAGTTCAGAATGCTGGGCAGAACCTTAAGCTGCCCAGGTTTCTCCAGGGCCTCCCGTTAGAAAAACAAGCTACTCGAAAGTAGTGGTAGCTCCTATCCTTTCGTCCTTTTGAAGTAGAGATCAGATAGAGCTCTTGAACTTCAAGTGCCCAGACGCGGAGTTAAGAGGCATCTTGGTAAAACAAAGATAAACACACACTAGCCGCTCTCCTTCCCCTCTCCCTCCTTCCTTCCTT