Transcript asmbl_24172

Sequence
Transcript Sequence for observation asmbl_24172 of TGE0004407:
GAAAAATGGCAGTACCATCAGCTCTGAGCTTTTAGCTCCAAGGCGCAAGACGCTTACAAACATGCCCCCACTGGGTGCCCACCCCTTTCCCTCCAAACGGCGGTGCCTGGGGCAAGACCGCAGCTTAGCTTTTTTCCTGTTTTCAAGGGTGTGCCACTTCCATTTTATCAGCCCACCGAAGAGGAGGGAGACTTTGAGCAGAACATGGTCCTGGTGGCCTGTGGACCATACACCACGTCTGACAGCATCACATATGACCCCCTGCTCGACCTGATCACCATCATCAACCACGACCAGCCAGACATCTGCATCCTGTTTGGCCCTTTCCTGGATGCTAAGCATGAACAGGTTGAGAACTGTCTGCTGACGAGTTCGTTCGAAGATGTTTTCAAGCAGTGTCTACGAACAATTGTCGAAGGGACTCGAAGCTCCGGCTCCCACCTCGTCTTTGTCCCGTCGCTGAGAGATGTCCAGCACGAGCCCGTGTACCCACAGCCACCTTTCAGCTACTCCGACCTGCCTCATGAGGACAGGAAGCGAGTGCAGTTCGTGTCTGACCCCTGCAGCCTCTCCGTGAATGGTGTGGTCCTTGGCCTGACGTCCACGGATCTGCTGTTCCACATGGGGGCCGAGGAGATCAGCAGTTCTTCTGGAACTTCAGACAGATTCAGCCGAATACTGAAGCACATCCTGACCCAGAGGAGCTACTACCCGCTCTACCCTCCCCAGGAAGACATGGCCATTGACTACGAGAGTTTCTGCGCCTACGCACAGCTGCCCGTCACCCCGGATGTCTTCATAGTCCCGTCAGAGCTGAGGTACTTCGTGAAGGACGTCCTTGGCTGTGTCTGCGTGAATCCTGGACGCCTCACCAAAGGGCAGGTGGGGGGCACCTATGGCCGGCTCTACCTCAGGAGGCAGACCCCAGAGGCCGGGGAGGGGAGGCGGAGTCCATGTGTTGCTGCCCAGGTGGTCAGGATCTGAGCCTTCAGGCACTTTGTCCCCCACTGTGCGGGCCTGGAGGCCCTAGGACCCAGGACTATCTGACAAGATTCCGCCCCGTTGGAAGGTGAAGAAGAGGAGGCGGCCACAGCTGGGGCGTGGAGGCCGCGGGGGCGGGCCCAGCACAGAAGACATCATGCAGCCGTCTCGGACTTCGAGTGAGCTCCATTGGAAGAACGCCTTTGCTCCTGATACACGGATTATAACGTGAACTGCCTGTGGATGCAGCACACTTGGAAAAAGCGAGAAGGCTTTATGACCTTCTACACGAATAAGACAACTTTTGGAGAAATAAAAGTAAATTCTGAGTGTAA