Transcript asmbl_33992

Sequence
Transcript Sequence for observation asmbl_33992 of TGE0005119:
AGGAAACTTGAACGTAACTTCAAAAGAAGATTTGATTTTTTTGTATCTGGATCACGTATATACAGCAAGACCGTCAGAATGTCGGGAGCCTCAGTGAAGGTGGCTGTCCGCGTGCGGCCCTTCAATTCTCGAGAGACCAGCAAAGAGTCCAAGTGCATCATTCAGATGCAAGGCAACTCCACCAGTATTGTTAACCCAAAGAACCCAAAGGAAGCTCCAAAGTCCTTCAGCTTTGACTACTCCTACTGGTCTCACACCTCGCCAGAAGATCCCTGTTTTGCATCTCAAAACCGAGTGTACAATGATATTGGAAAGGAAATGCTCTTACATGCTTTCGAGGGATATAATGTCTGTATTTTTGCCTATGGGCAGACTGGTGCTGGGAAATCTTACACGATGATGGGTAAACAAGAAGAAAGCCAGGCTGGCATCATTCCACAGCTGTGTGAAGAACTATTTGAGAAAATCAATGACAACTGTAATGAAGACATGTCTTACTCTGTAGAGGTGAGCTACATGGAAATTTACTGTGAAAGGGTACGCGATTTGCTGAATCCAAAAAACAAGGGTAATTTGCGCGTGCGTGAGCACCCACTTCTTGGCCCGTATGTGGAGGATCTGTCAAAGTTGGCAGTCACTTCCTACACAGACATTGCTGACCTCATGGATGCTGGGAACAAAGCCAGGACAGTGGCAGCTACCAACATGAATGAAACAAGTAGCCGTTCCCACGCTGTGTTTACAATTGTTTTCACCCAGAAGAAACATGACGCCGAGACCAACCTTTCCACTGAGAAGGTCAGTAAGATCAGCTTGGTGGATCTAGCGGGAAGTGAACGAGCTGACTCAACTGGTGCCAAAGGGACTCGATTAAAGGAAGGAGCAAATATTAATAAGTCTCTTACAACTCTGGGCAAAGTCATTTCAGCCTTGGCAGAGGTGAGTAAGAAGAAGAAGAAAACTGATTTTATTCCCTACAGGGATTCTGTACTTACTTGGCTCCTTCGAGAAAATCTAGGTGGCAATTCTCGGACTGCCATGGTTGCTGCCCTGAGCCCAGCAGATATCAACTATGATGAAACTTTGAGCACTCTGAGGTATGCAGATCGTGCAAAGCAGATTAAATGCAATGCTGTTATCAATGAGGACCCCAATGCCAAGCTGGTCCGTGAACTAAAGGAGGAGGTGACGCGGCTGAAGGATCTTCTTCGTGCTCAGGGCCTGGGAGACATCATCGATACGTCCATGGGGTCCCTTACTTCATCTTCATCTTCCTGCTCACTCAATAGTCAGGTGGGCTTAACATCTGTGACCAGTATTCAGGAGAGGATCATGTCTACCCCCGGAGGAGAGGAAGCCATCGAACGTCTGAAGGAGTCTGAGAAGATCATTGCTGAGTTGAATGAAACCTGGGAAGAGAAGCTGCGTAAAACAGAGGCCATCAGAATGGAGAGAGAGGCCTTGTTGGCTGAGATGGGCGTTGCCATCCGGGAAGATGGAGGAACCCTGGGCGTTTTCTCACCTAAAAAGACCCCACATCTCGTTAACCTCAATGAGGACCCACTAATGTCGGAATGCCTGCTTTATTACATCAAGGATGGACTTACAAGGGTCGGCCAGGCGGATGCCGAGAGGCGCCAGGACATCGTGCTGAGTGGGGCGCACATTAAAGAAGAGCATTGTGTCTTCCGGAGCGAGAGGAGCGACAGCGGGGATGTTATCGTGACGCTAGAGCCCTGTGAACGCTCAGAAACCTACGTAAATGGCAAGAGGGTGGCCCAGCCTGTTCAGCTGCGTTCAGGAAACCGTATCATCATGGGTAAAAACCACGTGTTTCGTTTTAACCACCCCGAGCAAGCACGGGCTGAGCGGGAGAAGACACCCTCTGCCGAGACCCCCTCTGAGCCTGTGGACTGGACGTTTGCCCAGAGAGAGCTTCTGGAAAAACAGGGGATTGATATGAAACAGGAGATGGAGAAAAGGTTACAGGAAATGGAGATCCTGTACAAAAAGGAGAAAGAGGAAGCAGACCTTCTCCTGGAGCAGCAGAGACTGGACGCGGATTCTGATAGCGGGGATGATTCTGACAAGAGGTCCTGCGAAGAGAGCTGGAAACTGATTACTTCTTTGAGAGAAAAGCTACCTCCCAGCAAGTTGCAAACCATTGTTAAAAAATGTGGCCTCCCGAGCAGTGGGAAGAAACGGGAACCAATTAAAATGTACCAGATACCCCAAAGAAGGCGCCTCAGTAAAGATTCCAAGTGGGTCACCATCTCAGACCTTAAGATTCAGGCCGTCAAAGAGATTTGCTACGAGGTGGCGCTCAACGATTTTAGGCACAGTCGGCAGGAGATCGAAGCCTTGGCCATCGTTAAGATGAAAGAGCTTTGCGCCACGTACGGGAAGAAAGATCCCAACGAGCGGGACTCCTGGAGGGCGGTGGCCAGGGATGTCTGGGACACCGTGGGAGTAGGCGACGAGAAGATCGAAGATGTGATGGCCAGTGGTAAAGGCGGAACCGACGTGGATGACCTCAGGGTTCACATAGACAAGCTGGAAGATATTTTGCAAGAGGTCAAAAAGCAAAATAACATGAAAGACGAGGAGATAAAAGTCTTAAGAAATAAAATGCTCAAAATGGAGAAAGTCTTGCCACTGATCGGGTCGCAGGAACAGAAGACCCAAGGAAACCATAAAGCGAAGGAACCTGTCGGTGCCGGCGTCAGTAGCAAGTCTGAGAATGACGTCAGTAAAGGAGACGGTGGGGAGCTTGGGTTGTTTCCCAGCTGATGAACGGGGACCCAGCTTTCCGACGTGGACGTCTGCGCTGGATGAGGCAGGAGCAGATCCGGTTCAAGAACCTGCAGCAGCAGGAGATAACAAAGCAGCTTCGTCGGCAGAACGTGCCCCATAGGTTCATCCCTCCTGAGAACCGGAAGCCCCGCTTCCCCTTTAAGAGCAATCCTAGACACAGGAACTCTTGGAGTCCTGGCACACACATCATCATAACGGAAGACGAGGTTATAGAGCTTCGAATACCGAAGGATGAAGACGGAAGGAAAGGAAATAAAGAGGAGAGCCAAGAGAAGGGTGGTAGAGCAGCTTCTAAGGACCCCCAGTTACCATGGGGCTCTCAGGTCACCCGAAGTCAAGATCACATCCAAGTGAGCAAGCAGCACCTTAATACTCAACAACAGCCACCTCAGTTACGCTGGAGGAGCAATTCCCTCAATAACGGCCAGCAGAAGAGCGTGCGCTGCCAGGCATCTGCCTCCTCGGAGTCGTTAAACTCCCACGGAGGTCACCCCACCGCCGATCTGCAGACTTTCCAGGCCAAGCGCCATATCCATCAACACCGTCAGTCTTACTGTAATTATAACACTGGAGGTCAGTTAGAGGGCAGTGCGGCCAGTTCCTATCAGAGGCAGACTGACAAAGCCAACCACTGTAGCCAGTTTGTGACACCTCCGCGGATGAGGCGACAGTTCTCGGCACCCAATCTCAAAGCTGGTCGAGAAACCACAGTATAAATTACTGGACAAACTTGAAATCCCAGTGGAGGAAGCAGACGATGTTAGCTCCTGATTTGAGTTGGTTCTAGCCTTGGCCTTGAGTTCCTACTAATTACATCATGATTTGAATGTCGCGTTCTTACAAACATTAACTGATTTTCATACTGTCAAAACATAAAACACTGGTCAATGTTTCAACGCCTCCCTTTTGTTTGTATACCATAAATGGGCAGTTTCTGGAATTTTGGACAAAATACTGAGACCTCTCTTTTTTGCTGAGACTTTCCTCCTTTCTTGGTGCCTAGATAATATACTTACTTACAGACTGGTCTCGTTTGGTATAAGTTTGTTATGTTTTTATAACGCCTATAAGTTGATCTGATATCCAGAAAGACCTGCCTCTTGGTTTATGCACACATTCAAAAGGGGAATTGGATACATAGAAATAAATGTCTGTTGTTTCCCCATGAATGTTAGACGTTAGTTTAAAAATAATAACATGCAACTATGTGGACATAGCTTTGGATTTCTCATCCGTGTCTGTCCTTTTGAAAAAGATAATTGGACTTTTCATAAGCCAAAATGAAACGTCTTCAGACACATTTTGTAGTACACAGCTCTGCCTCTTCCACAGAACTTTACATCTTATTCTACATTTTACACAGAACTAATTTCAGTAGGATTTTTTTTCTTTTGAATGTATCAGTGTATGTATGAAATTTGTCATAATACTGAAATATTTGGCACCATATCTGGATTTCTGTTTGTAGTTTGAATTTTGAAATGATCATTTCTCACACGCACTGAACTATTCACCAAAACCATGCCACCAGAAATACCAGAAAAATGCTTCAAGCCGTATATATAAGTTTATAGGGAAGTTCTTTGGTGGAGAGAGGGAAGAGGTGGGACGTGGGGAGAAGGCTGCAGCTTCTG