Transcript asmbl_33980

Sequence
Transcript Sequence for observation asmbl_33980 of TGE0005114:
CCTAGCGCCATTTTGTGGGAGCGAAGCGGTAGCTGGGCTGCTCCTGGATCCCTGGCTGCTCCGCGTCTCCGTGTCGGGCTTCCTAGCAGCAGCCTAGCGGAAAAATAAAAGATGTCTGAATATATTCGGGTAACCGAAGACGAGAATGATGAACCCATCGAAATACCATCAGAAGACGATGGGACAGTACTGCTTTCCACAGTTACAGCTCAGTTTCCAGGGGCCTGTGGGCTGCGCTACAGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTGGAAGGAATTCTGCATGCCCCGGATGCTGGCTGGGGAAATCTGGTATATGTTGTCAACTATCCCAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCAGCAGTGAAAGTGAAAAGAGCAGTTCAGAAAACATCTGATTTAATAGTGTTGGGTCTCCCATGGAAAACAACTGAACAAGATCTAAAAGAATATTTTAGTACCTTTGGAGAAGTTCTTATGGTTCAGGTCAAGAAAGATATTAAAACTGGTCATTCAAAAGGCTTTGGCTTTGTTCGATTTACGGAATATGAAACCCAGGTGAAAGTAATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGTAAACTTCCTAATTCTAAGCAAAGCCCAGATGAACCTTTGAGAAGCAGAAAGGTGTTCGTTGGGCGTTGTACGGAGGACATGACTGCTGATGAGTTGCAGCAGTTCTTCTGCCAGTATGGAGAAGTGGTAGATGTCTTCATTCCCAAACCGTTCAGGGCTTTTGCCTTTGTTACATTTGCAGATGATCAGGTTGCCCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTACATATATCCAATGCTGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTCGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAACAGTAGGGGGGGCGGAGCTGGCTTGGGAAACAATCAAGGTAGTAATATGGGTGGGGGGATGAACTTTGGTGCTTTTAGCATTAATCCAGCAATGATGGCTGCAGCCCAGGCAGCACTGCAGAGCAGCTGGGGTATGATGGGCATGCTAGCCAGTCAGCAGAATCAGTCAGGCCCATCAGGTAATAACCAAAGCCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTTGGTTCTGGAAATAATTCTTATAGTGGTTCTAATTCAGGTGCAGCAATTGGTTGGGGATCAGCATCAAATGCAGGGTCAGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAACCTTCTAGCTGGGGAATGTAGACAGTGGGCGATGGTTGTATAGACTGGTGGGAATTCAAATTTTTCTAAACTCATGGTAAGTATATTGTAAAATACATATGTACTAAGAATTTTCAAAATTGGTTTGTTCAGTGTGGAGTATATTCAGCAGTATTTTTGACATTTTTCTTTAGAAAAAGAAGAAGAGCTAAAGGAATTTTATAAGTTTTGTTACATAAAGGGTTGAAATATTGAGTGTTTGAAAGTGAACTGCTGTTTGCCTGATTGGTAAACCAACACACTACAATTGATATCAAAAGGTTTCTCCTGTAATATTTTATCCCTGGACTTGTCAAGTGAATTCTTTGCATGTTCAAAATGGAAACCATTGATTAGAACTACATTGTTTTCTCCTTGTTTTAATTTGAACCCCACCGTATGGATTTTTTTCCTTAGGAAAACTCTCCGTTTTGGAGATCATGGTGTCACAGTGTTTGGTTCTTTTGTTTGTTTTTTAACACTTGTCTCCCTTCATATACAAAAGTACAATATGAAGCCTTCATTTAATCTCTGCAGTTCATCTCATTTCAAATGTTTATGGAAGAAGCACTTCATTGAAAGGAGTGCTGTAAATGCTCTGCCATAGGAATCCTTCCGCCTACATGCTTTCTCATTCAGGAATTTGTCATCACGCTGCACAGGCTGCGTCTTTGACGGTGGGTGTCCCATTTTTATCCGCTACTCTTTATTTCATGGAGTCGTATCAACGCTATGAACGCAAGGCTGTGATATGGAACCAGAAGGCTGTTTGAACTTTTGAAACCTTGTGTGGGATTGATGGTGGTGCCGAGGCATGAAAGGCGAGTATGAGCGAGAAAAGGAGAGCGCGTGCAGAGACTTGGTGGTGCATAATGGATATTTTTTAACTTGGCGCGATGTGTCTCTCAATCCTGTGGCTTTGGTGAGAGAGTGTGCAGAGAGCAATGATAGCAAATAATGTACGAATGTTTTTTGCATTCAAAGGACATCCACCTCTGTTGGAAGACTTTAAGTGAGTTTTGTTCTTAGATAACCCACGTTAGTTGAATGTGTTAAGTGAAACGATACTTGTATTTCCCCTACCCCTTTGTCAACTGCTGTGAATGCTGTATGGTGTGTGTTCTCTTCTGTTACTGACCTGTAAGTGTGGTAATGTGAACTGAAGCTGATGGGTTGAGAACATGGACTGAGCTTGTGGTGTGCTTTGCAGGAGTACTTGGAAGCAGAGTTCACCAGTGAGCTGGGGGTGTCTCAAAGAAGGGTGGAAGTTCTAATGTCTGTTAGCTACCCATAAGAATGCTGTTTGCTGCAGTTCTGTGTCCTGTGCTTGGATGCTTTTTATAAGAGTTGTCAATGTTGGAAATTCTTAAATAAAACTGATTTAAATAATATGTGTCTTTGTTTTGCAGCCCTGAATGCAAAGAATTCATAGCAGTTAATTCCCCTTTTTGACCCTTTT