Transcript asmbl_33917

Sequence
Transcript Sequence for observation asmbl_33917 of TGE0005109:
NNNNNCTAGGGCGTCGGACCGGAGCCGGCTGGTGTGCGGGCGACCCAGTGGAGCTGGCCTGACCTTGGGGACTTTGGCTATCCTAGGAGAATCCAGTTCTCAGCCCACCAGGAGCCGAGGCAATGGCCTCAAAACCTGAGAAGCGCATCGCCTCGTCTGTCTTTATCACCCTGGCACCCCCACGTCGACACGAGGCTGTGGCTGAGGAAGTGAGGCGGGCAGCTTGTGAGGCCCGGCCCGGCCGCACCAGGGAGTCTTCCGCCCCCATGAAGGCAGCCGGGGCCGGCTCAGCAGAGAGGCCCAGTCTCTGGACGGCCCCCGGCAGGGCCGCAGCCCCGGTGCCAGCTGTGCCGCCTCAGCTCTCCAATGGAGGATGCTCTCTTCCTCCTCCAGCCCTGGATGGCGAGGACGCACTCCCCGACCTGGACCTCCTCCCACCTCCGCCGCCGCCCCCACCCGCATACCTGCCACCTTGCGATGACCAGCCTCCAGCCTCAATGGGGGCGTCACTCATTTCAGATTTAGAGCAGCTGCACCTGCCCCCGTCCCCACCACAGTCCCTGGCGGAGGGGGCTCCATTCCAGCCTCAGCCCGGTCATCTCAGGCCTGCGGAGGAGAAGTTGCCGCCTCCCCCAGCAGAGCCTGTTGGCTTGGCTGAGAGAGAGGCATCCACAGACATCTGTGCCTTCTGCCACAAGACCGTGTCCCCCCGAGAGCTGGCCGTGGAAGCCATGAAGAGGCAGTACCACGCCCAGTGCTTCACGTGCCGCACCTGTCGCCGCCAGCTGGCCGGGCAGAGCTTCTACCAGAAGGATGGGCGGCCCCTCTGCGAACCCTGCTACCAGGACACCCTGGAGAAGTGTGGCAAGTGTGGTGGGGTGGTCCAGGAACACATCATCAGGGCCCTGGGCCGGGCCTTCCACCCAGCCTGCTTCACGTGTGTGACCTGTGCCCGCTGCATCGGGGACGAGAGCTTTGCCCTGGACAACCAGAATGAGGTGTACTGCCTGGATGACTTCTATAGGAAATTTGCCCCTGTGTGCAGCATCTGTGAGAATCCCATCATCCCCCGAGATGGGAAGGATGCCTTCAAAATCGAGTGCATGGGAAGAAATTTCCATGAAAACTGCTACAGGTGTGAGGACTGCAGGATCCTCCTGTCCGTGGAGCCCACGGACCAAGGCTGCTACCCCTTGGACAACCGTCTCTTCTGCAAGCCATGCCATGTGAAGCGGAGTGCCGCAGGGTGCTGCTGAGAGCCCCACCAGGCCCTGGGGCCCTGAGCCACCCACTGGCCCTGGTCAGGAGGGGGGGATCCTCCCTGCCTCGGTTTCCCTTCCTGACCTGCTCTTGCACACTTTCCTTCCTAGCCACGAGGACCAGCCCGTCATGTCTGTGACCCCAGCTCAGGAGTGGGTGGCAGGCAGAAGGTGCCTCTCAGAATTTTGCCTCCTCCTCTCCCCTGGGCGTAGGAAGTCTTCATGCGTGAGTGTCGCACCCTAGGTGTGCGCTCTGAGCTCTGAGCCTCTGGCCCCTCTTGAGCGCTGGCCTTGACCCCATTTCCAGGGGTGAGTCGGGGCGAGTCTCTGGGAGGCACCCTGTGTCCCTAGCAATGACACTTTCATTGTCCCGTATGAGGTGCTGAGATCAGCTCTGCCTTGCAGGACTGAGCTGTTTGAGTAAAACTCCAAGGTCCCTTAAAAAGCACTTTTAAAAAAAAAGTGAGGTTTAAATGATGGGGCACATTTTTTGTATTTTTGGGGGGGTCAGTCTTAATAGGTAATGTCTTCCATGCGTTCATAAATGTACAAGAAGGTGACCTGGTTTTGGCACAGCCATGGACTTCTCAGCTGGGTGACGTGGAGCCCGGGACCAGCTGTAAACCCAAGGAGCAGAGGCAGGAGGGGAGTGCGAGGTATGGGACAGGCAAGGCAGCCTCTCCACCCTGCCCCCTGGCGCTCCTCCTGCATGCAACAGTGAGTCAACAGACATTAAGTACCTGGTGTATGCTGGGAACAAGGTGCAGGAGCTCTGAGTGTTCTTCCTGCAGCCTTGACTGGGGCCGTGCCACACCCCCAAGCCACACGCACACGCGCCCCTCCAGGACAGTCCCTCGGTTATCCCCCTAAGTTCCCACTTGGGCCCTTCTGCCCAGGCAGCCCCGTGACCACTGCCTCCTCAAGGCCACACCTAGAGGAGACGTCTTTCCTTTTAAGGAAAATCACTTTCTTTGCTTTGTAACTTCTAGACATTTTCAGGGCATGGACCAATGTCCATGCAAGATGTGCTGTCCTCCCTGCAGCCGTCTCAGTGTCCCACCCACTCCTCTGAGCATGCCCGCCTCCACAGACTGGGGGTGCTTCTCCACGGAACCCCTCAGGGGCTGCAGACCAGAGTATGGCTTCCTGCCCAAAGCTTAGAGCAGCGAGTCCCCAAACCAGGCATTCACATACCATCTACACAATTTTTGTCCTAACCAAGGACCTCCTATTCTCGTATTTCCTTAACATTGTCTTTAAACCAACATACTTTTAAAGATTCACTTCCAGCTGTAGTCTTGTGCTAAGCAATATAGCTATGCGGTCACATGTTGATGTGCTAGTTATGTTTTTTCCTATCACACATGAAAATAAATGCATAACTATTAGAAGTC