Transcript asmbl_33752

Sequence
Transcript Sequence for observation asmbl_33752 of TGE0005094:
CGCAACAGCGCCCGCTCGCGTTGGCGTTCTCTGCCTTCGCTCCTTCCGCCCAGGAAACCGGAAGTAGCCTCTCTCCCGGTGGCTCCTACGCGGTTAACGGATCCTCAGTGGACGCTGGCTGCGCGCCAAGGTAGTCAACGTGATACCTGCAGAGAGTGACTTCGGGGTTAAGGGTGGTGCTGGACGTCAGGAGCCAACATGGCAGCGGTGGTCGGAGTCTCCTTGAGGCGTCGATTCCCAGCCACAGCCTTTGGCGGAGCCTGCCTGCAGGCCTGCCGAGGGGCCCAGACAGCTGCAGCCACAGCTCCCCGAATCAAGAAATTTGCCATCTACCGATGGGACCCAGATAAGACTGGAGATAAACCTCATATGCAAACTTATGAAATTGATTTGAATAAATGTGGCCCCATGGTGTTGGATGCTTTAATCAAAATTAAGAATGAAATCGATTCTACCTTGACCTTCCGAAGATCATGCAGAGAAGGGATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACACGCTGGCTTGCACCAAAAGGATCGACACCAACCTCAACAAAGTCTCAAAAATCTACCCGCTTCCACATATGTATGTGATAAAAGATCTTGTTCCTGATTTGAGCAACTTCTATGCTCAGTACAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCCCAGGAAGGCAAGCAGCAGTATCTGCAGTCCATAGAAGAGCGCGAGAAACTGGATGGGCTCTACGAGTGCATCCTCTGCGCCTGCTGCAGCACCAGCTGCCCTAGCTACTGGTGGAATGGAGACAAGTATTTGGGGCCTGCGGTTCTTATGCAGGCCTATCGCTGGTTGATTGACTCCAGAGACGACTTCACAGAGGAGCGCCTGGCCAAGCTGCAGGACCCGTTCTCTCTGTATCGCTGCCACACCATCATGAACTGCACACAGACCTGCCCCAAGGGGCTGAATCCAGGGAAAGCTATTGCTGAAATCAAGAAAATGATGGCAACTTACAAGGAGAAGAAGGCGTCAGCTTAATTGTTCTCACACCAAACGTGACTTGCAACCAGCTCAGCTGGACATAACTTACATCTAATTTGGGTTCTTTCAGAGGTCTTCACTGTCCATGAATACAGCATGTATAATAAAACTTTTAAGAAATAAATAAATGTTAT