Transcript asmbl_33732

Sequence
Transcript Sequence for observation asmbl_33732 of TGE0005083:
CGAGGAGGCGCCACCATCTTTGGGCTCCTGGCCCCTACAGCGGTTAGTGGCGGCGGGAGCTGAGGAAGTAGGTGGGCCGGGTCGCGCCGCCTCCGGTGCCGGCCGTCCCTCCGTCTACCTTTCCGCCGCGGGCTCACCATGCCGCAGTATCAGACCTGGGAGGAGTTCAGTCGCGCGGCCGAGAAGCTCTACCTCGCCGACCCTATGAAGGCACGTGTGGTTCTCAAATATAGGCATTCTGATGGGAGTTTGTGTATTAAAGTAACAGATGATTTAGTTTGTTTGGTGTATAGAACAGACCAAGCTCAAGATGTAAAGAAGATTGAGAAATTCCACAGTCAACTAATGCGACTTATGGTAGCCAAGGAATCCCGCAGTGTTGCCATGGAAACAGACTGAATGGTTTGAAATGAAGACTGTTTGACATGTTCTTAGGAGTAAACATCTTTTGAATTTGAGGAAGTGTTGGGACAGAAAATACTTTATGTAACTAAGTGGGCTATTCAGAAGCCAAAAGATCATTTTTTTGTACATTGTTTTTTTAATGTTTCCTTTAGAGAGCTGGGAATAGAAATGATTTCGATTAGAAAGCCTTTATTTATTTTTGGAAATTGAACAAGAACTGCATCTATCTTGGGAACTTTTTGCGGATTATTTAATGCTGGGCAAAATATATAGCTATTTCTTTTGGTAAATTCGTATTGGTAATTTGAAAATGAGATGTCAAGAAAAGTCTATTCTTTAAATTTAGTTTATCCATCTTTAAAAGAAAATTAAACTCAACCATTTTACCGAATCGATAGACTTCTTTTGGAGCATAAAATTTGTATTGTTGATGACTAACAAATATAAACTATGGTAACTAGAATTAACTGCATAGCAGTATACCTAACAATATACAGTAGTATAGTCTAGATTGTATCTGAAAATAATTATGAAAACAAGTATGCTTTACCTTAAACTTTCAAAACTTAATCTATATTTTTGAGTATAAGAGTTTTATAATATTAATAGTTTGTTGAGCAGACTTACTTTGAATCTAGTTTTCAGTGCTCAAAACAACTGCAGTTCCTTTAAATGCATGAACAGAATATTCAGCGATGGACTGAAACCAGCATGTTACAGAAGTATTTGCCACACATTTCCCATCTGTAGTTTCTAAGAAGGGCTAAGGATTATGTAAATTGTTAAATTTTTGCAAAGCTCTTTGACACCCCTCCCCATTTCTCTACTTATCCAGCGGGTTAGCTTGACTGTCACACTTGTTATGTTTTCCATTAAACCAGAAGTATGATATTTAGTATTATCTATTTGTAACCTTAATTTTACCACCTAAATGTAATGTTCACTTGTCGATTCCTACATTAAAATATTTTTGGTATGGAACTTTCCATATTCCATTTTAATATGGAAAGTTCCATTAGCCATACAAATTTTGACATGTTTCAGAGAGGTCAATAAATAAAATATTATGTGGCTATATATTATTTCTCTCAAAGTTTTTAACTTCTCAAGAATCACTGATTTCTTAACTGGGATGTGCTGTATTCATGTCTAAAATGAGCTTAATGATACTGTAAATTTTGTTTTATTTTTTTGGTACTTTTATTACATGACTTTCTGTGAGCTGTATGTTAATGGCAAGGTTCTGTTCTTGGTTAAGAAAAGTAGCATCAAATAGTGTGGGACGTTTTGAGTTTCAGTTCTCTCCCCGCCCCCCCTTCCCAAAGTAGTGGAATCACTGGAGGGTTTTTTTGGCCTTTTTCTTTTCTCATTTACGTCTTCCACTTTTTAATGCTGCTTTATAAAGATAACCAGAGAGGGCTGGGCTAATTCTGGCTCGAGTCCTCAGTAGCTTGTGGGAGAGTGGTTAGAGCAGAGGTTCCAAGGCGGGCCGCCTGTGCTGCAGTCTCGGCTCCACTGCTTCCTATCACTGTGGTCTTGGAAAAGGCACTTCTGTAAGGCTCCGTGTTCCTCTGGAGATTGAGTTAACAGTAGTACTCATAGGACTTCATGAAGATTAAAGGGCATAATCCATTTTAAGCCTTTAGCACAGTGCCTGGAACATAGTAAAACTATTATTTCGGCCAACTATTGTTATTATTAGTCTTAATAGACTATAAACTCCCTTAAGTTTTCTTTTAATTTTAATTGAATAATTATTTATTGGTAATGTCTGCCTTTTCTGCCAGTCTGTGTCTATTATTAAATGCCGTTTTTGGCAGTTGAGAAATACAACAAGATTGCCCTCAGAGTGATCTTATTCGGGGGCAAATCCTTAAATCTAAAACTTGTGTTCATTCATAGCTGTATAAAGTAAAATCATTGAACTAATTGGTGGTAAAAGTATTGAATCTCTTAAAAACCATATAAATAATAAAACATCACATTCTGAAAATCGCA