Transcript asmbl_33417

Sequence
Transcript Sequence for observation asmbl_33417 of TGE0027454:
ATGGGTAGCTGGTGCTTTGAGCCCAGAGAGGGAATTGGGGCCTGTATATCAGAGATGTTAAGGACAAAATCATTGGCTTCCTCGCTGTGAAGGGGCTTCTGCAGAGGTCATATGCTTGGAATGACAGACCTTTGAGAACCCCTCATTTTGTGGGGTTCCCCAGCTAATGGGGAACAGAGCTGAGATTGAAAGCCAAGTCTCCCAGGCATCACTCCAGGGCTCGCGCTGTCTGCCACACTTGACTGCCCTGTTACCATTCCCAGAGCAGCCCTTGTTCACACGTGCTGTACCAGTGTGGTTCTTACAAGCATCTCCTTTCACTCTCGTGTGTACCTGCATCAGGAATGTCTGCCTTCGGAGCTTATCTGCTTCAACATTTGTTGTCCTGTCCCCCAAGACCCCCAGAACACATTCGAACCTTGTGCTCTTGCCCCACAGGCCCAAATGGGGGAGGGAAACAGGATATTTTCCTTCAAAGGGCAGTGGGCAACCAGAGAAGGCCTTGAAGACACCCTCTCCCCATCTGTACCTTCATTTGCCTCAGACACAACAGGCTGGGGCGTGAGCCCCCGTGGAGCTGGCTACCTATTTGGCAGTGATGTGGTGGCCCAGTTCAATGCAGCCAACGACATTGACATGATCTGTCGTGCCCACCAACTGGTGATGGAAGGTTACAAGTGGCACTTCAATGAGACTGTGCTCACTGTGTGGTCAGCACCCAACTACTGCTACCGCTGTGGGAACGTGGCAGCCATCTTGGAGCTAGATGAGCATCTCCAGAAAGATTTTATCATCTTCGAGGCCGCTCCTCAAGAGACACGGGGCATCCCCTCCAAGAAGCCCGTGGCTGACTACTTCCTGTGACCCCTTTGGCCCCTGTCCCCCTCCAGCCCCTCTGGCCCTTGGACCACTGTGACTGCCCTCTTCAGACAGAGGCTGGGCATTGGGGGGCTGTCCCCGGCTCTGCTCTCCCCACAAAGAGGGCACTTTGAGGGTGAGGACTTTCTCTGGAGAGGCTCAGAGCCTCAGCTCCATGCTCCTCCTCTCCCTTCTCCCCACTTGAACCATGAAGTTTCCAAGAATTTTTTTGGTTTTTTTTTTCCTTTTTTTGTTTGTTTTTAGATAAAAATTTTGAGAAAAAGAAAAAAATTCTAATAAAAGAAGAAAAATGGTA