Transcript asmbl_3291

Sequence
Transcript Sequence for observation asmbl_3291 of TGE0030065:
GTTGGCGGTAGCCAATAGGAGGCGCGCTGGCTGGAGAGTAATGTTACAGAGCGGAGAGAGTGAGGAGGCTGCGTCTGGCTCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGCGAGCCGGACGGGCACTGGGCGACTCTGTGCTCGCGGAGGAAAAATAATTAATCATGGGCAAAGGAGATCCTAAGAAGCCCAGAGGCAAAATGTCATCATATGCATTCTTTGTGCAAACTTGCCGGGAGGAGCACAAGAAGAAGCACCCAGATGCTTCAGTCAACTTCTCAGAGTTTTCTAAGAAGTGCTCAGAGAGGTGGAAGACCATGTCTGCTAAAGAGAAAGGAAAATTTGAAGACATGGCAAAAGCGGACAAGGCCCGCTACGAAAGAGAAATGAAAACTTATATCCCCCCCAAAGGGGAAACAAAAAAGAAGTTCAAGGATCCCAATGCACCCAAGAGGCCTCCTTCGGCCTTTTTCTTGTTTTGTTCTGAGTATCGCCCCAAAATCAAAGGAGAGCACCCCGGCCTGTCCATTGGTGACGTCGCGAAGAAGCTGGGAGAGATGTGGAATAACACGGCTGCAGACGACAAGCAGCCTTACGAAAAGAAGGCTGCCAAGCTGAAGGAGAAATACGAAAAGGATATCGCCGCATACCGAGCTAAAGGAAAGCCTGACGCTGCGAAAAAGGGCGTCGTCAAGGCCGAGAAGAGCAAGAAGAAGAAGGAGGAGGAGGAGGACGAGGAGGACGAAGAGGAGGAGGAGGAGGACGAGGACGAGGA