Transcript asmbl_24023

Sequence
Transcript Sequence for observation asmbl_24023 of TGE0004390:
CTCTCGGAGGACAGGCCGCTGGGTACCGGGAAGGAGCGGCAACGCTTCAAGGAATGGGACAAGATGACACAGTGCCACTGAGGTCAAGGGTCAGGGCTCCTGCAGTGTCAGAGTCCTGGGGGGCCGGGTCTGGGACCCACCGCACCTCCCGTGCTTTTCATGCTGACAGATGCGCTGCCTGACTACACCCACGCTGCTTCGGGCCCTGGTCCAGGCCGCACACACAGGGCATTCTAGTGGCCGGAGCCTGCACAGCGGCGCAGTGGCAGCCACCTATAAGTACGTGAACGCGCAAGAGCCCTCCATGGACATGAAGTCGGTGACTGACCGGGCAGCTCAGACCCTGCTGTGGACGGAGCTCATCCGAGGCCTGGGCATGACCCTGAGCTACCTGTTCCGGGAGCCAGCCACCATCAACTACCCGTTTGAGAAGGGCCCGCTGAGCCCGCGTTTCCGCGGGGAGCACGCGCTGCGCCGTTACCCATCCGGGGAGGAGCGCTGTATCGCCTGCAAGCTTTGCGAGGCCGTCTGCCCCGCCCAGGCCATCACCATCGAAGCCGAGCCTCGGGCTGACGGCAGCCGCCGGACCACCCGCTACGACATCGACATGACCAAGTGCATCTACTGTGGCTTCTGCCAGGAGGCCTGCCCCGTGGACGCCATCGTCGAGGGCCCTAACTTCGAGTTCTCCACGGAGACGCATGAGGAGCTGCTGTACAACAAGGAGAAGCTGCTGAACAATGGGGACAAGTGGGAGGCTGAGATCGCTGCCAACATCCAGGCCGACTACCTCTACCGGTGACACTCCTGCCCGGCTGGCCCGCAGCCCCTGCTGCCCAATAAAGAAGCTCTGCTCTCCC