Transcript asmbl_32446

Sequence
Transcript Sequence for observation asmbl_32446 of TGE0005017:
ACCAAAATCCACGACTTGGCCCTCCGAGCAGATTATGAGATTGCAAGTAAAGAAAGGGACCTGTTTTTTGAATTGGATGTGGAAGGGGGAGCTCTACCCTCAGAACATGAGGGGTAATATTTGCGTGGCTCACAAAGACCAGCAATGGATCACTTGGAGTCCTTCATTGCTGAATGTGATCGGAGAACTGAGCTTGCCAAGAAGCGGCTGGCAGAGACACAGGAGGAGATCAGCGCAGAAGTTTCTGCAAAGGCAGAAAAAGTACATGAGTTGAATGAAGAAATAGGAAAACTTCTTGCTAAAGCTGAGCAGCTGGGAGCTGAAGGAAATGTGGATGAATCCCAGAAGATTCTTATGGAAGTGGAGAAAGTCCGTGCAAAGAAAAAAGAAGCTGAGGAAGAATACAGAAATTCCATGCCTGCATCCAGTTTTCAACAGCAGAAATTGCGTGTCTGTGAAGTCTGCTCTGCTTACCTTGGCCTCCATGACAATGACCGTCGCCTTGCAGACCACTTTGGGGGCAAATTGCACTTGGGGTTCATTCAGATCCGTGAGAAACTGGATCAGTTGAGGAAAACTGTGGCTGAAAAGCAGGAGAAGAGAAATCAGGATCGCTTGAGGAGGAGAGAAGAGAGGGAGCGGGAGGAGCGGCTGAGCAGGAGGTCTGGCTCAAGAACCAGAGAGCGCAGGAGGTCACGTTCCCGGGACCGGCGTCGGAGGCGGTCAAGATCTACCTCCAGAGAGCGACGAAAGTCTTCCCGGTCCCGGTCCCGTGACAGACACCGGCGCCACCGCAGTCGTTCCCGGAGCCACAGCCGGGGCCACCGCCGGGCTTCCAGGGACCGGAGTGCGAAATACAAGTTCTCCAGAGAGCGGGCGTCGAGGGAGGAGTCCTGGGAGCGCGGGCGGAGCGAGCGGGGGGCCACCGACTGGAGGCTCGAGAGCTCCAACGGGAAGACGGCTTCGCGGAGGTCGGAGGAGAAGGAGGCTGGCGAGATCTGAACCCATGCCCAGGCACTGTAAATAGTCTGATAAACGTTCAACATGCCTGAGGTTACTCTTTATATTTGCTGAATACAACTCATCTTTTGTAGTTTAAAATTTCTATTGTTTCAGAGCTAGCTGTGAGTTTCTAGAGATGTACAGTTGCTCCTGTGTTCTGGGGTTATGTCGAGTAGGAATAAAT